FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628141_at:

>probe:Drosophila_2:1628141_at:237:473; Interrogation_Position=8787; Antisense; GTTCTAGCTTGGTTCATGATTGCCA
>probe:Drosophila_2:1628141_at:322:619; Interrogation_Position=8816; Antisense; TGCTTTTAACATTTACACACCCATA
>probe:Drosophila_2:1628141_at:79:675; Interrogation_Position=8878; Antisense; TAGCCACTAGCGAAACTACATCTAT
>probe:Drosophila_2:1628141_at:356:683; Interrogation_Position=8902; Antisense; TATGCCTCTACCCATACCATATAAT
>probe:Drosophila_2:1628141_at:422:229; Interrogation_Position=8967; Antisense; AATGTTTTCGTATATCTGTGTTCTA
>probe:Drosophila_2:1628141_at:108:515; Interrogation_Position=8984; Antisense; GTGTTCTACGTGTTTATTTGCCATT
>probe:Drosophila_2:1628141_at:132:695; Interrogation_Position=9000; Antisense; TTTGCCATTAAATTGCCCATATATA
>probe:Drosophila_2:1628141_at:64:137; Interrogation_Position=9030; Antisense; ACGAGATGTGCGAACTTATTCAGGC
>probe:Drosophila_2:1628141_at:416:19; Interrogation_Position=9115; Antisense; ATTTGGTTCTTCACTTTGTTGTTAT
>probe:Drosophila_2:1628141_at:547:175; Interrogation_Position=9197; Antisense; AAACTCTTGGTTTTCAGTCAGTCTA
>probe:Drosophila_2:1628141_at:223:541; Interrogation_Position=9205; Antisense; GGTTTTCAGTCAGTCTATGTTCTAT
>probe:Drosophila_2:1628141_at:374:509; Interrogation_Position=9234; Antisense; GTGAATTTTCTTCGATGTAATCAAT
>probe:Drosophila_2:1628141_at:475:481; Interrogation_Position=9276; Antisense; GTATATACGTACGTGTGCGAGTCGT
>probe:Drosophila_2:1628141_at:36:509; Interrogation_Position=9290; Antisense; GTGCGAGTCGTGTATGCAGTTGCAT

Paste this into a BLAST search page for me
GTTCTAGCTTGGTTCATGATTGCCATGCTTTTAACATTTACACACCCATATAGCCACTAGCGAAACTACATCTATTATGCCTCTACCCATACCATATAATAATGTTTTCGTATATCTGTGTTCTAGTGTTCTACGTGTTTATTTGCCATTTTTGCCATTAAATTGCCCATATATAACGAGATGTGCGAACTTATTCAGGCATTTGGTTCTTCACTTTGTTGTTATAAACTCTTGGTTTTCAGTCAGTCTAGGTTTTCAGTCAGTCTATGTTCTATGTGAATTTTCTTCGATGTAATCAATGTATATACGTACGTGTGCGAGTCGTGTGCGAGTCGTGTATGCAGTTGCAT

Full Affymetrix probeset data:

Annotations for 1628141_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720