FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628142_at:

>probe:Drosophila_2:1628142_at:407:225; Interrogation_Position=113; Antisense; AAGGACGACCGCAGAGGATCGCCGA
>probe:Drosophila_2:1628142_at:272:635; Interrogation_Position=131; Antisense; TCGCCGAGTGCCGAGAGCTCTGCTA
>probe:Drosophila_2:1628142_at:326:103; Interrogation_Position=144; Antisense; AGAGCTCTGCTACCGGCAATCCTTG
>probe:Drosophila_2:1628142_at:17:451; Interrogation_Position=197; Antisense; GATCCCGTCCAGACTGCTACATGTG
>probe:Drosophila_2:1628142_at:579:45; Interrogation_Position=209; Antisense; ACTGCTACATGTGCCACGACTACTG
>probe:Drosophila_2:1628142_at:20:505; Interrogation_Position=238; Antisense; GTCCTGGACGTTGTGCAGCGCAGTC
>probe:Drosophila_2:1628142_at:526:445; Interrogation_Position=283; Antisense; GATCGGGAGTTCTGCACCCGCGGAT
>probe:Drosophila_2:1628142_at:714:61; Interrogation_Position=306; Antisense; ATGTCGGGTGGCCTGTTCGTACCAT
>probe:Drosophila_2:1628142_at:407:603; Interrogation_Position=319; Antisense; TGTTCGTACCATCGCCTGAGGATAT
>probe:Drosophila_2:1628142_at:699:605; Interrogation_Position=335; Antisense; TGAGGATATTCCACTTCACCCAGGA
>probe:Drosophila_2:1628142_at:214:57; Interrogation_Position=34; Antisense; ATGACCATCCTGTGTGTGAGCATCT
>probe:Drosophila_2:1628142_at:40:327; Interrogation_Position=361; Antisense; GCGACTGCCAATGCGGTGATCAAAA
>probe:Drosophila_2:1628142_at:163:513; Interrogation_Position=49; Antisense; GTGAGCATCTTTATCGCTGGCAATG
>probe:Drosophila_2:1628142_at:302:629; Interrogation_Position=91; Antisense; TCCACATCCGCCGTAGGACTAAAAG

Paste this into a BLAST search page for me
AAGGACGACCGCAGAGGATCGCCGATCGCCGAGTGCCGAGAGCTCTGCTAAGAGCTCTGCTACCGGCAATCCTTGGATCCCGTCCAGACTGCTACATGTGACTGCTACATGTGCCACGACTACTGGTCCTGGACGTTGTGCAGCGCAGTCGATCGGGAGTTCTGCACCCGCGGATATGTCGGGTGGCCTGTTCGTACCATTGTTCGTACCATCGCCTGAGGATATTGAGGATATTCCACTTCACCCAGGAATGACCATCCTGTGTGTGAGCATCTGCGACTGCCAATGCGGTGATCAAAAGTGAGCATCTTTATCGCTGGCAATGTCCACATCCGCCGTAGGACTAAAAG

Full Affymetrix probeset data:

Annotations for 1628142_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720