FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628144_at:

>probe:Drosophila_2:1628144_at:352:241; Interrogation_Position=379; Antisense; AATACAAATAGTGCTCCTGGCTCCT
>probe:Drosophila_2:1628144_at:555:367; Interrogation_Position=451; Antisense; GAATCGGCGACCATAGGCATCATGC
>probe:Drosophila_2:1628144_at:583:569; Interrogation_Position=466; Antisense; GGCATCATGCCAGCAGGATCCGGAA
>probe:Drosophila_2:1628144_at:322:401; Interrogation_Position=644; Antisense; GACAGGTCGATCTCGATGTGCCAAT
>probe:Drosophila_2:1628144_at:640:627; Interrogation_Position=662; Antisense; TGCCAATTGCCTTCTGTTACACAGT
>probe:Drosophila_2:1628144_at:522:507; Interrogation_Position=685; Antisense; GTGAGGCTCCAACTTAACGAATCGA
>probe:Drosophila_2:1628144_at:578:127; Interrogation_Position=730; Antisense; ACCACCGCCAGGAGGAGCAATCAGA
>probe:Drosophila_2:1628144_at:392:589; Interrogation_Position=759; Antisense; TGGATGCGATGGTCTCTTCGAGAAC
>probe:Drosophila_2:1628144_at:51:291; Interrogation_Position=795; Antisense; CGGATGCCAGCTGTGCCAGGACGAT
>probe:Drosophila_2:1628144_at:719:555; Interrogation_Position=813; Antisense; GGACGATGGATGCAACCAGCCCATG
>probe:Drosophila_2:1628144_at:665:267; Interrogation_Position=834; Antisense; CATGGCCATCGGATCATCCAGTAGA
>probe:Drosophila_2:1628144_at:532:249; Interrogation_Position=868; Antisense; CAATTCTGGACACTGCTGGCTGGAC
>probe:Drosophila_2:1628144_at:681:287; Interrogation_Position=883; Antisense; CTGGCTGGACTCATGCTAATGGCAT
>probe:Drosophila_2:1628144_at:532:339; Interrogation_Position=897; Antisense; GCTAATGGCATTTATGACCCGCCGC

Paste this into a BLAST search page for me
AATACAAATAGTGCTCCTGGCTCCTGAATCGGCGACCATAGGCATCATGCGGCATCATGCCAGCAGGATCCGGAAGACAGGTCGATCTCGATGTGCCAATTGCCAATTGCCTTCTGTTACACAGTGTGAGGCTCCAACTTAACGAATCGAACCACCGCCAGGAGGAGCAATCAGATGGATGCGATGGTCTCTTCGAGAACCGGATGCCAGCTGTGCCAGGACGATGGACGATGGATGCAACCAGCCCATGCATGGCCATCGGATCATCCAGTAGACAATTCTGGACACTGCTGGCTGGACCTGGCTGGACTCATGCTAATGGCATGCTAATGGCATTTATGACCCGCCGC

Full Affymetrix probeset data:

Annotations for 1628144_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720