Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628145_at:

>probe:Drosophila_2:1628145_at:478:55; Interrogation_Position=1103; Antisense; ATGAACCGCCAACGGCAGCTGTCAC
>probe:Drosophila_2:1628145_at:679:515; Interrogation_Position=1171; Antisense; GTGGGCTATGGCCTCCAGATTAGCT
>probe:Drosophila_2:1628145_at:184:629; Interrogation_Position=1208; Antisense; TCCTCACTAGCCTCAAAATGGGCGA
>probe:Drosophila_2:1628145_at:249:229; Interrogation_Position=1224; Antisense; AATGGGCGATCAATCGGCGTCGGCC
>probe:Drosophila_2:1628145_at:328:625; Interrogation_Position=1262; Antisense; TGCCGGGCACAACGGTGTCATCCGC
>probe:Drosophila_2:1628145_at:323:531; Interrogation_Position=1303; Antisense; GGTGTAACTGCCTCCGAGTTTCAGG
>probe:Drosophila_2:1628145_at:479:297; Interrogation_Position=1313; Antisense; CCTCCGAGTTTCAGGCCAAGATCAA
>probe:Drosophila_2:1628145_at:164:653; Interrogation_Position=1334; Antisense; TCAATGCCGAGATGCAGAAGCAGCT
>probe:Drosophila_2:1628145_at:291:533; Interrogation_Position=1359; Antisense; GGTGGCCGCCGATCTGAAATTCAAG
>probe:Drosophila_2:1628145_at:585:265; Interrogation_Position=1392; Antisense; CAGTATCCAAGAGGCCAAGCAGCGC
>probe:Drosophila_2:1628145_at:385:253; Interrogation_Position=1407; Antisense; CAAGCAGCGCCGGTTCGAGCAACTG
>probe:Drosophila_2:1628145_at:665:127; Interrogation_Position=1586; Antisense; ACCAAGGTGGCTCCGAGTTCATGAA
>probe:Drosophila_2:1628145_at:469:269; Interrogation_Position=1605; Antisense; CATGAAACTCTACTACGATGACTAC
>probe:Drosophila_2:1628145_at:649:407; Interrogation_Position=1630; Antisense; GACGACTCCAACTCGGACAGTGACG

Paste this into a BLAST search page for me
ATGAACCGCCAACGGCAGCTGTCACGTGGGCTATGGCCTCCAGATTAGCTTCCTCACTAGCCTCAAAATGGGCGAAATGGGCGATCAATCGGCGTCGGCCTGCCGGGCACAACGGTGTCATCCGCGGTGTAACTGCCTCCGAGTTTCAGGCCTCCGAGTTTCAGGCCAAGATCAATCAATGCCGAGATGCAGAAGCAGCTGGTGGCCGCCGATCTGAAATTCAAGCAGTATCCAAGAGGCCAAGCAGCGCCAAGCAGCGCCGGTTCGAGCAACTGACCAAGGTGGCTCCGAGTTCATGAACATGAAACTCTACTACGATGACTACGACGACTCCAACTCGGACAGTGACG

Full Affymetrix probeset data:

Annotations for 1628145_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime