FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628146_at:

>probe:Drosophila_2:1628146_at:333:311; Interrogation_Position=6637; Antisense; GCCACCGCCGGAAGAGCGACTAATT
>probe:Drosophila_2:1628146_at:423:299; Interrogation_Position=6723; Antisense; CGCCCATATACACCTAGCTGTAGGA
>probe:Drosophila_2:1628146_at:136:603; Interrogation_Position=6757; Antisense; TGTTTTGTACTAAGTTGGCCCCTAG
>probe:Drosophila_2:1628146_at:374:343; Interrogation_Position=6770; Antisense; GTTGGCCCCTAGTTATGGTTTACAT
>probe:Drosophila_2:1628146_at:581:65; Interrogation_Position=6784; Antisense; ATGGTTTACATCTTAAGGTGCTCAA
>probe:Drosophila_2:1628146_at:57:45; Interrogation_Position=6859; Antisense; ATCCCCTGCCTACGCTTTAGTTAGT
>probe:Drosophila_2:1628146_at:631:233; Interrogation_Position=6888; Antisense; AATGCCGTTGTCTATTTATTCTAGT
>probe:Drosophila_2:1628146_at:688:477; Interrogation_Position=6914; Antisense; GTTTAGATGACATACGTACCGCCCT
>probe:Drosophila_2:1628146_at:17:487; Interrogation_Position=6929; Antisense; GTACCGCCCTATAGTCGTTATGTAG
>probe:Drosophila_2:1628146_at:336:463; Interrogation_Position=6972; Antisense; GATTCAGTATTCGATTTCTCGTATA
>probe:Drosophila_2:1628146_at:385:483; Interrogation_Position=6992; Antisense; GTATATGTAATCCTAAAGCTGCGAA
>probe:Drosophila_2:1628146_at:713:183; Interrogation_Position=7015; Antisense; AACAAAGTTGAGCTCCGACGTCGAT
>probe:Drosophila_2:1628146_at:321:689; Interrogation_Position=7039; Antisense; TTTCCCCTTTGCATTCCACAAGGAA
>probe:Drosophila_2:1628146_at:384:465; Interrogation_Position=7102; Antisense; GATTGTTTGCCGACTCTTAAACTAA

Paste this into a BLAST search page for me
GCCACCGCCGGAAGAGCGACTAATTCGCCCATATACACCTAGCTGTAGGATGTTTTGTACTAAGTTGGCCCCTAGGTTGGCCCCTAGTTATGGTTTACATATGGTTTACATCTTAAGGTGCTCAAATCCCCTGCCTACGCTTTAGTTAGTAATGCCGTTGTCTATTTATTCTAGTGTTTAGATGACATACGTACCGCCCTGTACCGCCCTATAGTCGTTATGTAGGATTCAGTATTCGATTTCTCGTATAGTATATGTAATCCTAAAGCTGCGAAAACAAAGTTGAGCTCCGACGTCGATTTTCCCCTTTGCATTCCACAAGGAAGATTGTTTGCCGACTCTTAAACTAA

Full Affymetrix probeset data:

Annotations for 1628146_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720