Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628147_at:

>probe:Drosophila_2:1628147_at:376:195; Interrogation_Position=4205; Antisense; AACTGGAGCTTCTCCTACATCTGAG
>probe:Drosophila_2:1628147_at:27:667; Interrogation_Position=4220; Antisense; TACATCTGAGTCCAAGTTTTAGCCT
>probe:Drosophila_2:1628147_at:329:495; Interrogation_Position=4229; Antisense; GTCCAAGTTTTAGCCTATTTCTCAA
>probe:Drosophila_2:1628147_at:580:271; Interrogation_Position=4294; Antisense; CTTTTCTTTAAACAACTGACGCGAT
>probe:Drosophila_2:1628147_at:429:135; Interrogation_Position=4312; Antisense; ACGCGATTAGTCTGTAAGCTTTCCA
>probe:Drosophila_2:1628147_at:336:493; Interrogation_Position=4325; Antisense; GTAAGCTTTCCAGTACCAAATTCAT
>probe:Drosophila_2:1628147_at:385:13; Interrogation_Position=4350; Antisense; ATTCATGTTAGGTGAGTTCGACTCT
>probe:Drosophila_2:1628147_at:395:429; Interrogation_Position=4363; Antisense; GAGTTCGACTCTTGTTTAGTTATCA
>probe:Drosophila_2:1628147_at:700:91; Interrogation_Position=4380; Antisense; AGTTATCAATTTCTGCTCACTGACC
>probe:Drosophila_2:1628147_at:208:19; Interrogation_Position=4388; Antisense; ATTTCTGCTCACTGACCCAAATATT
>probe:Drosophila_2:1628147_at:550:365; Interrogation_Position=4420; Antisense; GAATCATGTTTCTGTTCTCTGGCAT
>probe:Drosophila_2:1628147_at:321:479; Interrogation_Position=4427; Antisense; GTTTCTGTTCTCTGGCATCAATGCA
>probe:Drosophila_2:1628147_at:525:167; Interrogation_Position=4498; Antisense; AAATGTTCCTTGTAGACGTGATTGA
>probe:Drosophila_2:1628147_at:336:273; Interrogation_Position=4607; Antisense; CATATTTGCTTCTATTTGCTTGTTA

Paste this into a BLAST search page for me
AACTGGAGCTTCTCCTACATCTGAGTACATCTGAGTCCAAGTTTTAGCCTGTCCAAGTTTTAGCCTATTTCTCAACTTTTCTTTAAACAACTGACGCGATACGCGATTAGTCTGTAAGCTTTCCAGTAAGCTTTCCAGTACCAAATTCATATTCATGTTAGGTGAGTTCGACTCTGAGTTCGACTCTTGTTTAGTTATCAAGTTATCAATTTCTGCTCACTGACCATTTCTGCTCACTGACCCAAATATTGAATCATGTTTCTGTTCTCTGGCATGTTTCTGTTCTCTGGCATCAATGCAAAATGTTCCTTGTAGACGTGATTGACATATTTGCTTCTATTTGCTTGTTA

Full Affymetrix probeset data:

Annotations for 1628147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime