Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628150_a_at:

>probe:Drosophila_2:1628150_a_at:384:575; Interrogation_Position=128; Antisense; GGCGCTGATAAATCCACGCTCGAGC
>probe:Drosophila_2:1628150_a_at:267:119; Interrogation_Position=150; Antisense; AGCTGCTGCATGTGGTATTCCGACA
>probe:Drosophila_2:1628150_a_at:30:153; Interrogation_Position=172; Antisense; ACATGGACCACGAACGCCGGCGGAT
>probe:Drosophila_2:1628150_a_at:574:479; Interrogation_Position=199; Antisense; GTATCCCAGGGATCCCTATGTAAAT
>probe:Drosophila_2:1628150_a_at:583:157; Interrogation_Position=220; Antisense; AAATGAGACCTACTATCCCTTTGGC
>probe:Drosophila_2:1628150_a_at:76:241; Interrogation_Position=260; Antisense; AATAATGGCAAACGCGAGCTGTTCA
>probe:Drosophila_2:1628150_a_at:522:473; Interrogation_Position=280; Antisense; GTTCAACATTGGTACTTGGCTGCGT
>probe:Drosophila_2:1628150_a_at:192:727; Interrogation_Position=31; Antisense; TTGTCTCGCGATGACGGGCGGACTA
>probe:Drosophila_2:1628150_a_at:411:65; Interrogation_Position=312; Antisense; ATGGCAAATTTCTGGCGCCCAACTA
>probe:Drosophila_2:1628150_a_at:730:257; Interrogation_Position=383; Antisense; CACATGACCATGCAGACCGTTCTGG
>probe:Drosophila_2:1628150_a_at:428:241; Interrogation_Position=446; Antisense; AATAGTCGGTTTAATTGGCAGCCCA
>probe:Drosophila_2:1628150_a_at:380:599; Interrogation_Position=475; Antisense; TGTCTTCTCCCAGGAACTCAATGAG
>probe:Drosophila_2:1628150_a_at:117:405; Interrogation_Position=51; Antisense; GACTAATTGCATCGGCGGTCATAAT
>probe:Drosophila_2:1628150_a_at:395:289; Interrogation_Position=66; Antisense; CGGTCATAATCTGGTGCGTCGCTCA

Paste this into a BLAST search page for me
GGCGCTGATAAATCCACGCTCGAGCAGCTGCTGCATGTGGTATTCCGACAACATGGACCACGAACGCCGGCGGATGTATCCCAGGGATCCCTATGTAAATAAATGAGACCTACTATCCCTTTGGCAATAATGGCAAACGCGAGCTGTTCAGTTCAACATTGGTACTTGGCTGCGTTTGTCTCGCGATGACGGGCGGACTAATGGCAAATTTCTGGCGCCCAACTACACATGACCATGCAGACCGTTCTGGAATAGTCGGTTTAATTGGCAGCCCATGTCTTCTCCCAGGAACTCAATGAGGACTAATTGCATCGGCGGTCATAATCGGTCATAATCTGGTGCGTCGCTCA

Full Affymetrix probeset data:

Annotations for 1628150_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime