FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628152_at:

>probe:Drosophila_2:1628152_at:693:257; Interrogation_Position=1028; Antisense; CACACAGTTGTCATGCTTTCCTTGA
>probe:Drosophila_2:1628152_at:654:685; Interrogation_Position=1054; Antisense; TATCATATACCCCATCACACAAAAT
>probe:Drosophila_2:1628152_at:279:121; Interrogation_Position=616; Antisense; AGCTGGACGACTGGTTGCGCCAGAT
>probe:Drosophila_2:1628152_at:420:465; Interrogation_Position=638; Antisense; GATTGGCGAGTCCATATCGAAGACC
>probe:Drosophila_2:1628152_at:627:375; Interrogation_Position=656; Antisense; GAAGACCAAACTGGCGTCGCGGAAT
>probe:Drosophila_2:1628152_at:125:565; Interrogation_Position=676; Antisense; GGAATGCCGAGAAACAAGCCGCCAC
>probe:Drosophila_2:1628152_at:718:421; Interrogation_Position=705; Antisense; GAGAATGGCACCATCGAGCCGGGCA
>probe:Drosophila_2:1628152_at:475:63; Interrogation_Position=734; Antisense; ATGGGAGCGCATAGCCAAGCTCTGC
>probe:Drosophila_2:1628152_at:560:641; Interrogation_Position=754; Antisense; TCTGCGACTTCAATCCCAAGGTGAA
>probe:Drosophila_2:1628152_at:503:559; Interrogation_Position=786; Antisense; GGAAAGGACGTCTCCCGCATGCGAT
>probe:Drosophila_2:1628152_at:44:235; Interrogation_Position=834; Antisense; AATCCCATCCAGGTGCAGAAGAGCA
>probe:Drosophila_2:1628152_at:126:485; Interrogation_Position=864; Antisense; GTAGTTTTAATTACGCACTCGCCTA
>probe:Drosophila_2:1628152_at:432:393; Interrogation_Position=921; Antisense; GAAAGTATTCGCTGTATATTCCAAT
>probe:Drosophila_2:1628152_at:408:319; Interrogation_Position=985; Antisense; GCCGCGATCATCGTTTTGTCTAATG

Paste this into a BLAST search page for me
CACACAGTTGTCATGCTTTCCTTGATATCATATACCCCATCACACAAAATAGCTGGACGACTGGTTGCGCCAGATGATTGGCGAGTCCATATCGAAGACCGAAGACCAAACTGGCGTCGCGGAATGGAATGCCGAGAAACAAGCCGCCACGAGAATGGCACCATCGAGCCGGGCAATGGGAGCGCATAGCCAAGCTCTGCTCTGCGACTTCAATCCCAAGGTGAAGGAAAGGACGTCTCCCGCATGCGATAATCCCATCCAGGTGCAGAAGAGCAGTAGTTTTAATTACGCACTCGCCTAGAAAGTATTCGCTGTATATTCCAATGCCGCGATCATCGTTTTGTCTAATG

Full Affymetrix probeset data:

Annotations for 1628152_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720