FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628154_at:

>probe:Drosophila_2:1628154_at:692:91; Interrogation_Position=122; Antisense; AGCTTTGGAGTATGTACCACCTTTA
>probe:Drosophila_2:1628154_at:285:251; Interrogation_Position=175; Antisense; CAAGGCATATTCACTGACAGTTCGT
>probe:Drosophila_2:1628154_at:74:401; Interrogation_Position=190; Antisense; GACAGTTCGTGTACTACTCTTTGCC
>probe:Drosophila_2:1628154_at:275:277; Interrogation_Position=208; Antisense; CTTTGCCTGCTTCCTTAATGATTTA
>probe:Drosophila_2:1628154_at:5:203; Interrogation_Position=238; Antisense; AACCAGCATATATGGTGGCGGCCTT
>probe:Drosophila_2:1628154_at:191:583; Interrogation_Position=253; Antisense; TGGCGGCCTTGCTAGTATATTGACA
>probe:Drosophila_2:1628154_at:463:65; Interrogation_Position=287; Antisense; ATGGACGAGGCAGCCGACACTGTCA
>probe:Drosophila_2:1628154_at:3:283; Interrogation_Position=314; Antisense; CGCTTGCGATTTCACCGATTACAGT
>probe:Drosophila_2:1628154_at:528:267; Interrogation_Position=335; Antisense; CAGTGGGCGGCCAACTCAGAGGCAT
>probe:Drosophila_2:1628154_at:511:647; Interrogation_Position=350; Antisense; TCAGAGGCATGGGTCTCGGCCATAC
>probe:Drosophila_2:1628154_at:263:29; Interrogation_Position=371; Antisense; ATACGCGCTTCTGATGAGGGTCACT
>probe:Drosophila_2:1628154_at:702:433; Interrogation_Position=386; Antisense; GAGGGTCACTTTGCTATCGGAAACT
>probe:Drosophila_2:1628154_at:172:523; Interrogation_Position=416; Antisense; GGGCCTCAAGCGATTGACCAGTTAG
>probe:Drosophila_2:1628154_at:716:471; Interrogation_Position=79; Antisense; GTATGTACTGCCTGGCTACCGAGAG

Paste this into a BLAST search page for me
AGCTTTGGAGTATGTACCACCTTTACAAGGCATATTCACTGACAGTTCGTGACAGTTCGTGTACTACTCTTTGCCCTTTGCCTGCTTCCTTAATGATTTAAACCAGCATATATGGTGGCGGCCTTTGGCGGCCTTGCTAGTATATTGACAATGGACGAGGCAGCCGACACTGTCACGCTTGCGATTTCACCGATTACAGTCAGTGGGCGGCCAACTCAGAGGCATTCAGAGGCATGGGTCTCGGCCATACATACGCGCTTCTGATGAGGGTCACTGAGGGTCACTTTGCTATCGGAAACTGGGCCTCAAGCGATTGACCAGTTAGGTATGTACTGCCTGGCTACCGAGAG

Full Affymetrix probeset data:

Annotations for 1628154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720