Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628155_at:

>probe:Drosophila_2:1628155_at:150:719; Interrogation_Position=8073; Antisense; TTCCTACGAGTTTAGGTTGCTGTTC
>probe:Drosophila_2:1628155_at:478:469; Interrogation_Position=8088; Antisense; GTTGCTGTTCGATTGAACGCTGAAT
>probe:Drosophila_2:1628155_at:74:77; Interrogation_Position=8126; Antisense; AGGAGCAGACGATGCCCAGCCACGT
>probe:Drosophila_2:1628155_at:369:127; Interrogation_Position=8143; Antisense; AGCCACGTGTAAACTGCCGCATAAA
>probe:Drosophila_2:1628155_at:293:249; Interrogation_Position=8231; Antisense; CAATTGAGTGGCGTTTTTGTATACT
>probe:Drosophila_2:1628155_at:286:145; Interrogation_Position=8272; Antisense; ACTAAAGTGCCTACAAATGCGAACT
>probe:Drosophila_2:1628155_at:434:325; Interrogation_Position=8290; Antisense; GCGAACTGTGAACGAGGAGCTACCA
>probe:Drosophila_2:1628155_at:725:483; Interrogation_Position=8353; Antisense; GTATGAATCCAAGGCACCGAAGCAA
>probe:Drosophila_2:1628155_at:660:587; Interrogation_Position=8417; Antisense; TGGAGCTCACCAGAACAGCGATGAA
>probe:Drosophila_2:1628155_at:110:673; Interrogation_Position=8463; Antisense; TACGCAACGCAACTATACACAATCA
>probe:Drosophila_2:1628155_at:526:35; Interrogation_Position=8484; Antisense; ATCAGTGCGGAGACAACGAATCTTC
>probe:Drosophila_2:1628155_at:170:367; Interrogation_Position=8501; Antisense; GAATCTTCAGCCAACACACATCATA
>probe:Drosophila_2:1628155_at:419:539; Interrogation_Position=8550; Antisense; GGATAAACCTTACACTTATTTTGCA
>probe:Drosophila_2:1628155_at:291:387; Interrogation_Position=8608; Antisense; GAAAATATCTCTTAGGTTCGTGTTT

Paste this into a BLAST search page for me
TTCCTACGAGTTTAGGTTGCTGTTCGTTGCTGTTCGATTGAACGCTGAATAGGAGCAGACGATGCCCAGCCACGTAGCCACGTGTAAACTGCCGCATAAACAATTGAGTGGCGTTTTTGTATACTACTAAAGTGCCTACAAATGCGAACTGCGAACTGTGAACGAGGAGCTACCAGTATGAATCCAAGGCACCGAAGCAATGGAGCTCACCAGAACAGCGATGAATACGCAACGCAACTATACACAATCAATCAGTGCGGAGACAACGAATCTTCGAATCTTCAGCCAACACACATCATAGGATAAACCTTACACTTATTTTGCAGAAAATATCTCTTAGGTTCGTGTTT

Full Affymetrix probeset data:

Annotations for 1628155_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime