FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628161_at:

>probe:Drosophila_2:1628161_at:585:287; Interrogation_Position=1039; Antisense; CTGGAGTTTATAGCCACGCAGCAAA
>probe:Drosophila_2:1628161_at:167:75; Interrogation_Position=1073; Antisense; AGGACAGCCTGGGACCGCTTGAGAA
>probe:Drosophila_2:1628161_at:137:363; Interrogation_Position=1099; Antisense; GAATTCGTTAATCTCCCGAGGGTGG
>probe:Drosophila_2:1628161_at:453:351; Interrogation_Position=1133; Antisense; GCAGCCAAACCTACCTGATGGTGGA
>probe:Drosophila_2:1628161_at:45:423; Interrogation_Position=1156; Antisense; GAGAATCTGGACACACAACTGAAGC
>probe:Drosophila_2:1628161_at:533:185; Interrogation_Position=1228; Antisense; AACAAGGGCCAGGACACCACTGATC
>probe:Drosophila_2:1628161_at:434:367; Interrogation_Position=1309; Antisense; GAATCGCAGTCGACGAACATCAGCA
>probe:Drosophila_2:1628161_at:366:211; Interrogation_Position=1361; Antisense; AAGACTCCCAGAAACGCGATATTTT
>probe:Drosophila_2:1628161_at:56:683; Interrogation_Position=1380; Antisense; TATTTTCCGAGCTCCTTTCTAAAGA
>probe:Drosophila_2:1628161_at:212:33; Interrogation_Position=871; Antisense; ATCAACAAGTGGACTCTCGAGTTCG
>probe:Drosophila_2:1628161_at:128:223; Interrogation_Position=907; Antisense; AAGGTATTCACCGAACAGGCCACTC
>probe:Drosophila_2:1628161_at:670:187; Interrogation_Position=920; Antisense; AACAGGCCACTCAGATCAACGCATG
>probe:Drosophila_2:1628161_at:102:201; Interrogation_Position=937; Antisense; AACGCATGGGACAAACTGCTCATCA
>probe:Drosophila_2:1628161_at:256:97; Interrogation_Position=974; Antisense; AGATCGTCGAGCTCAACGATGCCGT

Paste this into a BLAST search page for me
CTGGAGTTTATAGCCACGCAGCAAAAGGACAGCCTGGGACCGCTTGAGAAGAATTCGTTAATCTCCCGAGGGTGGGCAGCCAAACCTACCTGATGGTGGAGAGAATCTGGACACACAACTGAAGCAACAAGGGCCAGGACACCACTGATCGAATCGCAGTCGACGAACATCAGCAAAGACTCCCAGAAACGCGATATTTTTATTTTCCGAGCTCCTTTCTAAAGAATCAACAAGTGGACTCTCGAGTTCGAAGGTATTCACCGAACAGGCCACTCAACAGGCCACTCAGATCAACGCATGAACGCATGGGACAAACTGCTCATCAAGATCGTCGAGCTCAACGATGCCGT

Full Affymetrix probeset data:

Annotations for 1628161_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720