FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628162_at:

>probe:Drosophila_2:1628162_at:322:35; Interrogation_Position=118; Antisense; ATCAGCAGCCACATATGATCCTGTG
>probe:Drosophila_2:1628162_at:283:25; Interrogation_Position=130; Antisense; ATATGATCCTGTGGCGGCGCAACTT
>probe:Drosophila_2:1628162_at:214:675; Interrogation_Position=14; Antisense; TAGAATCCATCGAAACTTTGCCGGT
>probe:Drosophila_2:1628162_at:97:577; Interrogation_Position=145; Antisense; GGCGCAACTTCTGGATGTGGATGCA
>probe:Drosophila_2:1628162_at:369:63; Interrogation_Position=159; Antisense; ATGTGGATGCAGGTGTCCAGGCTCC
>probe:Drosophila_2:1628162_at:36:585; Interrogation_Position=186; Antisense; TGGCAGCACGCCAAGCACGTCAGTT
>probe:Drosophila_2:1628162_at:545:111; Interrogation_Position=199; Antisense; AGCACGTCAGTTTGGCGGCGGCTTT
>probe:Drosophila_2:1628162_at:273:303; Interrogation_Position=34; Antisense; CCGGTGATTAGTAGCAGAAGTTTCC
>probe:Drosophila_2:1628162_at:601:351; Interrogation_Position=456; Antisense; GCAGCAATCATCTGTGACTGACTAA
>probe:Drosophila_2:1628162_at:110:373; Interrogation_Position=50; Antisense; GAAGTTTCCTCGAAAATGCGCACAT
>probe:Drosophila_2:1628162_at:634:209; Interrogation_Position=523; Antisense; AAGCACGCTCTAATTAAGTTCGAAA
>probe:Drosophila_2:1628162_at:532:93; Interrogation_Position=539; Antisense; AGTTCGAAATACATTTGCCCCTCTT
>probe:Drosophila_2:1628162_at:646:625; Interrogation_Position=554; Antisense; TGCCCCTCTTCTTTGATTCACTTAA
>probe:Drosophila_2:1628162_at:353:167; Interrogation_Position=63; Antisense; AAATGCGCACATTTGTTTGCCTTGC

Paste this into a BLAST search page for me
ATCAGCAGCCACATATGATCCTGTGATATGATCCTGTGGCGGCGCAACTTTAGAATCCATCGAAACTTTGCCGGTGGCGCAACTTCTGGATGTGGATGCAATGTGGATGCAGGTGTCCAGGCTCCTGGCAGCACGCCAAGCACGTCAGTTAGCACGTCAGTTTGGCGGCGGCTTTCCGGTGATTAGTAGCAGAAGTTTCCGCAGCAATCATCTGTGACTGACTAAGAAGTTTCCTCGAAAATGCGCACATAAGCACGCTCTAATTAAGTTCGAAAAGTTCGAAATACATTTGCCCCTCTTTGCCCCTCTTCTTTGATTCACTTAAAAATGCGCACATTTGTTTGCCTTGC

Full Affymetrix probeset data:

Annotations for 1628162_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720