FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628164_at:

>probe:Drosophila_2:1628164_at:155:401; Interrogation_Position=1319; Antisense; GACCGTGGCGTTAGTTTCACCTTTG
>probe:Drosophila_2:1628164_at:61:307; Interrogation_Position=1338; Antisense; CCTTTGGCGCCGAAGTTGTGGTCAA
>probe:Drosophila_2:1628164_at:164:537; Interrogation_Position=1357; Antisense; GGTCAAGTTCCTCCAAAAGCACGAT
>probe:Drosophila_2:1628164_at:332:41; Interrogation_Position=1380; Antisense; ATCTGGATCTGATCTGTCGTGCCCA
>probe:Drosophila_2:1628164_at:286:123; Interrogation_Position=1440; Antisense; AGCGCCAATTGGTCACTTTGTTTTC
>probe:Drosophila_2:1628164_at:452:533; Interrogation_Position=1481; Antisense; GGTGAATTCGACAATGCTGGTGCCA
>probe:Drosophila_2:1628164_at:483:559; Interrogation_Position=1516; Antisense; GGACAATACACTCATGTGCTCCTTC
>probe:Drosophila_2:1628164_at:163:627; Interrogation_Position=1539; Antisense; TCCAAATCCTGAAGCCTGTCGAGAA
>probe:Drosophila_2:1628164_at:280:21; Interrogation_Position=1616; Antisense; ATATATTGTAACACGCGGCACGCGA
>probe:Drosophila_2:1628164_at:51:405; Interrogation_Position=1639; Antisense; GACTCATTCACAATATCCTACACGA
>probe:Drosophila_2:1628164_at:573:29; Interrogation_Position=1690; Antisense; ATACATCTCTAGTCAACCGGATCGA
>probe:Drosophila_2:1628164_at:263:651; Interrogation_Position=1725; Antisense; TCAACTACAACGTATACCTCCATGG
>probe:Drosophila_2:1628164_at:613:629; Interrogation_Position=1743; Antisense; TCCATGGATCCTAACTGTCTTCAGA
>probe:Drosophila_2:1628164_at:561:37; Interrogation_Position=1767; Antisense; AGGTATCCACTAGCCAATTCTTGCA

Paste this into a BLAST search page for me
GACCGTGGCGTTAGTTTCACCTTTGCCTTTGGCGCCGAAGTTGTGGTCAAGGTCAAGTTCCTCCAAAAGCACGATATCTGGATCTGATCTGTCGTGCCCAAGCGCCAATTGGTCACTTTGTTTTCGGTGAATTCGACAATGCTGGTGCCAGGACAATACACTCATGTGCTCCTTCTCCAAATCCTGAAGCCTGTCGAGAAATATATTGTAACACGCGGCACGCGAGACTCATTCACAATATCCTACACGAATACATCTCTAGTCAACCGGATCGATCAACTACAACGTATACCTCCATGGTCCATGGATCCTAACTGTCTTCAGAAGGTATCCACTAGCCAATTCTTGCA

Full Affymetrix probeset data:

Annotations for 1628164_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720