FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628168_at:

>probe:Drosophila_2:1628168_at:307:537; Interrogation_Position=298; Antisense; GGTCTGACCCACCTTATAGAGCTGA
>probe:Drosophila_2:1628168_at:522:677; Interrogation_Position=314; Antisense; TAGAGCTGACCCCACTTCGAAATAT
>probe:Drosophila_2:1628168_at:700:557; Interrogation_Position=349; Antisense; GGACATTCACTAGGAGCTCACATTA
>probe:Drosophila_2:1628168_at:381:151; Interrogation_Position=368; Antisense; ACATTATGGGCACTGCTGGTCGGAC
>probe:Drosophila_2:1628168_at:520:311; Interrogation_Position=445; Antisense; GCCAAGCCATGTTTCAGGCGGGAAA
>probe:Drosophila_2:1628168_at:199:133; Interrogation_Position=552; Antisense; ACCCCTCGGTGATGTGGACTTCTAT
>probe:Drosophila_2:1628168_at:681:25; Interrogation_Position=629; Antisense; ATACCCGAGCCGTTGAGTATTTCGC
>probe:Drosophila_2:1628168_at:315:689; Interrogation_Position=646; Antisense; TATTTCGCCGAGAGTGCATATCCAC
>probe:Drosophila_2:1628168_at:167:221; Interrogation_Position=697; Antisense; AAGTGCGCTTCTTGGGATGAGCTAA
>probe:Drosophila_2:1628168_at:651:195; Interrogation_Position=725; Antisense; AACGGGATTGTTCTGCTGGCATAGT
>probe:Drosophila_2:1628168_at:271:23; Interrogation_Position=745; Antisense; ATAGTTTCCCCGATGGGCTATCGAA
>probe:Drosophila_2:1628168_at:668:669; Interrogation_Position=796; Antisense; TACGTAGATGTCAATGGCTGGCCCC
>probe:Drosophila_2:1628168_at:528:423; Interrogation_Position=838; Antisense; GAGAACACTGTTGATCCTAGGCTTA
>probe:Drosophila_2:1628168_at:662:175; Interrogation_Position=863; Antisense; AAACGTGCTACTTGTGCCGGAGGTG

Paste this into a BLAST search page for me
GGTCTGACCCACCTTATAGAGCTGATAGAGCTGACCCCACTTCGAAATATGGACATTCACTAGGAGCTCACATTAACATTATGGGCACTGCTGGTCGGACGCCAAGCCATGTTTCAGGCGGGAAAACCCCTCGGTGATGTGGACTTCTATATACCCGAGCCGTTGAGTATTTCGCTATTTCGCCGAGAGTGCATATCCACAAGTGCGCTTCTTGGGATGAGCTAAAACGGGATTGTTCTGCTGGCATAGTATAGTTTCCCCGATGGGCTATCGAATACGTAGATGTCAATGGCTGGCCCCGAGAACACTGTTGATCCTAGGCTTAAAACGTGCTACTTGTGCCGGAGGTG

Full Affymetrix probeset data:

Annotations for 1628168_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720