FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628169_at:

>probe:Drosophila_2:1628169_at:245:379; Interrogation_Position=1037; Antisense; GAAGCGTCTTCCGACGACATGACAA
>probe:Drosophila_2:1628169_at:186:77; Interrogation_Position=1079; Antisense; AGGAGATCCATACGGCCATTGGCAA
>probe:Drosophila_2:1628169_at:169:321; Interrogation_Position=1120; Antisense; GCCGCCGATGAGATCAGCCTGAAGT
>probe:Drosophila_2:1628169_at:346:177; Interrogation_Position=1234; Antisense; AAACTGATGCTGTTCCAGGGACTGA
>probe:Drosophila_2:1628169_at:278:611; Interrogation_Position=1256; Antisense; TGAAAAAGGCTCACGGCGTCCAGGC
>probe:Drosophila_2:1628169_at:1:569; Interrogation_Position=1278; Antisense; GGCTTCGTAGGATCTATTCGCTTTA
>probe:Drosophila_2:1628169_at:159:151; Interrogation_Position=758; Antisense; ACATTTCAGCGCGTGTGTTCGAGCA
>probe:Drosophila_2:1628169_at:650:513; Interrogation_Position=772; Antisense; GTGTTCGAGCATCTCAACGAGTCCA
>probe:Drosophila_2:1628169_at:149:225; Interrogation_Position=796; Antisense; AAGGAGTTCGATCTTCTGCGCTCCA
>probe:Drosophila_2:1628169_at:698:43; Interrogation_Position=868; Antisense; ATCGACGACCTGCTGTATGACATGA
>probe:Drosophila_2:1628169_at:437:449; Interrogation_Position=891; Antisense; GATCCGTCGGGATTATCTGCACAAT
>probe:Drosophila_2:1628169_at:48:521; Interrogation_Position=919; Antisense; GTGGAGCTGATTGCTCTGAGCTACA
>probe:Drosophila_2:1628169_at:678:45; Interrogation_Position=955; Antisense; ATCCCAGTGGAGTATCAGGCAACGC
>probe:Drosophila_2:1628169_at:312:73; Interrogation_Position=971; Antisense; AGGCAACGCTGACCGAACTGGGCAA

Paste this into a BLAST search page for me
GAAGCGTCTTCCGACGACATGACAAAGGAGATCCATACGGCCATTGGCAAGCCGCCGATGAGATCAGCCTGAAGTAAACTGATGCTGTTCCAGGGACTGATGAAAAAGGCTCACGGCGTCCAGGCGGCTTCGTAGGATCTATTCGCTTTAACATTTCAGCGCGTGTGTTCGAGCAGTGTTCGAGCATCTCAACGAGTCCAAAGGAGTTCGATCTTCTGCGCTCCAATCGACGACCTGCTGTATGACATGAGATCCGTCGGGATTATCTGCACAATGTGGAGCTGATTGCTCTGAGCTACAATCCCAGTGGAGTATCAGGCAACGCAGGCAACGCTGACCGAACTGGGCAA

Full Affymetrix probeset data:

Annotations for 1628169_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720