FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628171_at:

>probe:Drosophila_2:1628171_at:530:627; Interrogation_Position=109; Antisense; TGCCATAACATATGCAGCTGCAGCT
>probe:Drosophila_2:1628171_at:647:617; Interrogation_Position=127; Antisense; TGCAGCTCCAGTCATCAAGTCCTAC
>probe:Drosophila_2:1628171_at:497:45; Interrogation_Position=14; Antisense; ATCCTTACCTCTCTGCTGGCTGTGG
>probe:Drosophila_2:1628171_at:173:51; Interrogation_Position=171; Antisense; ATGCGGCTCCAGCTCCGGTGATCAA
>probe:Drosophila_2:1628171_at:393:533; Interrogation_Position=262; Antisense; GGTGGTCAAGTCCTATGCTGCTCCT
>probe:Drosophila_2:1628171_at:151:53; Interrogation_Position=276; Antisense; ATGCTGCTCCTGTGGCGGTCAAGGT
>probe:Drosophila_2:1628171_at:414:669; Interrogation_Position=320; Antisense; TACTCGCACTTCAGCTCGGTTGTTT
>probe:Drosophila_2:1628171_at:674:321; Interrogation_Position=355; Antisense; GCCCATTGTTAAGTCGTACGCTGCG
>probe:Drosophila_2:1628171_at:33:621; Interrogation_Position=46; Antisense; TGCTCCTGGACTCCTTGATTATGGA
>probe:Drosophila_2:1628171_at:223:591; Interrogation_Position=486; Antisense; TGGTCAAGTCATATGCGGCTCCAGC
>probe:Drosophila_2:1628171_at:440:117; Interrogation_Position=523; Antisense; AGCTCCTGCCCTGGTTAAGTCATAC
>probe:Drosophila_2:1628171_at:636:589; Interrogation_Position=534; Antisense; TGGTTAAGTCATACGCTGCACCTGC
>probe:Drosophila_2:1628171_at:655:595; Interrogation_Position=561; Antisense; TGTCCCTGGGTGGATACGGTTACCA
>probe:Drosophila_2:1628171_at:628:723; Interrogation_Position=60; Antisense; TTGATTATGGACACTCGGCTCCGGA

Paste this into a BLAST search page for me
TGCCATAACATATGCAGCTGCAGCTTGCAGCTCCAGTCATCAAGTCCTACATCCTTACCTCTCTGCTGGCTGTGGATGCGGCTCCAGCTCCGGTGATCAAGGTGGTCAAGTCCTATGCTGCTCCTATGCTGCTCCTGTGGCGGTCAAGGTTACTCGCACTTCAGCTCGGTTGTTTGCCCATTGTTAAGTCGTACGCTGCGTGCTCCTGGACTCCTTGATTATGGATGGTCAAGTCATATGCGGCTCCAGCAGCTCCTGCCCTGGTTAAGTCATACTGGTTAAGTCATACGCTGCACCTGCTGTCCCTGGGTGGATACGGTTACCATTGATTATGGACACTCGGCTCCGGA

Full Affymetrix probeset data:

Annotations for 1628171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720