FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628172_at:

>probe:Drosophila_2:1628172_at:206:61; Interrogation_Position=6849; Antisense; ATGTCTCCTCCAACTATGTATTGTA
>probe:Drosophila_2:1628172_at:658:257; Interrogation_Position=6910; Antisense; CACTGAGTTGTGTTTCGTATGCGAT
>probe:Drosophila_2:1628172_at:292:405; Interrogation_Position=6974; Antisense; GACTGTGACTGAGACCGGGTTCCAT
>probe:Drosophila_2:1628172_at:249:413; Interrogation_Position=6986; Antisense; GACCGGGTTCCATTAGACAGCTTGT
>probe:Drosophila_2:1628172_at:89:401; Interrogation_Position=7001; Antisense; GACAGCTTGTTAGTTTATGCCTACG
>probe:Drosophila_2:1628172_at:20:681; Interrogation_Position=7016; Antisense; TATGCCTACGCTATTTTGTTTGAAT
>probe:Drosophila_2:1628172_at:355:537; Interrogation_Position=7087; Antisense; GGTCATTGTTTTTGCAACACGCGCC
>probe:Drosophila_2:1628172_at:622:321; Interrogation_Position=7107; Antisense; GCGCCTACTAGGATCGATTCTTGTT
>probe:Drosophila_2:1628172_at:705:155; Interrogation_Position=7166; Antisense; ACACCCCTCAAATTGTTTCAAGCCA
>probe:Drosophila_2:1628172_at:408:467; Interrogation_Position=7194; Antisense; GTTGGGCTCAGTGCGCGCTAAAAAC
>probe:Drosophila_2:1628172_at:303:663; Interrogation_Position=7237; Antisense; TAGCTAACCGTAGTTCTTACCAAAT
>probe:Drosophila_2:1628172_at:301:645; Interrogation_Position=7291; Antisense; TAAGACCCATTCAGTTTTACCCGCA
>probe:Drosophila_2:1628172_at:707:29; Interrogation_Position=7317; Antisense; ATACACACTTATTTCGATGCCGAGA
>probe:Drosophila_2:1628172_at:661:101; Interrogation_Position=7339; Antisense; AGAGCACGCATTACACGCAGGATAA

Paste this into a BLAST search page for me
ATGTCTCCTCCAACTATGTATTGTACACTGAGTTGTGTTTCGTATGCGATGACTGTGACTGAGACCGGGTTCCATGACCGGGTTCCATTAGACAGCTTGTGACAGCTTGTTAGTTTATGCCTACGTATGCCTACGCTATTTTGTTTGAATGGTCATTGTTTTTGCAACACGCGCCGCGCCTACTAGGATCGATTCTTGTTACACCCCTCAAATTGTTTCAAGCCAGTTGGGCTCAGTGCGCGCTAAAAACTAGCTAACCGTAGTTCTTACCAAATTAAGACCCATTCAGTTTTACCCGCAATACACACTTATTTCGATGCCGAGAAGAGCACGCATTACACGCAGGATAA

Full Affymetrix probeset data:

Annotations for 1628172_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720