FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628173_at:

>probe:Drosophila_2:1628173_at:452:541; Interrogation_Position=234; Antisense; GGATAACAGCGACGTGGCCACCCTT
>probe:Drosophila_2:1628173_at:727:35; Interrogation_Position=355; Antisense; ATCTACCTGCCCCAAATGCGAATAG
>probe:Drosophila_2:1628173_at:605:537; Interrogation_Position=382; Antisense; GGTCACTACAAAATGGTCGGTCGCA
>probe:Drosophila_2:1628173_at:166:699; Interrogation_Position=407; Antisense; TTTTGCTGGTGCCTCTGCAGGGAAA
>probe:Drosophila_2:1628173_at:680:451; Interrogation_Position=457; Antisense; GATCTGGACATACTGATGACCACCA
>probe:Drosophila_2:1628173_at:24:371; Interrogation_Position=498; Antisense; GAAGGGCGGCTATACATTTTACAAC
>probe:Drosophila_2:1628173_at:316:555; Interrogation_Position=546; Antisense; GGACGTCGGCAAAGTTCGCACCAGA
>probe:Drosophila_2:1628173_at:364:727; Interrogation_Position=571; Antisense; TTGGATAACCTCTTCAACGGGCACA
>probe:Drosophila_2:1628173_at:681:143; Interrogation_Position=660; Antisense; ACTGCGTCCGCTGGTGGTTGAAACC
>probe:Drosophila_2:1628173_at:323:107; Interrogation_Position=691; Antisense; AGAACGCTACTAGATCTACTCCACA
>probe:Drosophila_2:1628173_at:410:669; Interrogation_Position=707; Antisense; TACTCCACAAGACATTTGCCCTGTT
>probe:Drosophila_2:1628173_at:696:717; Interrogation_Position=731; Antisense; TTCCGGCCAGCTTCTTTGTGGAGGA
>probe:Drosophila_2:1628173_at:460:125; Interrogation_Position=763; Antisense; ACCTCCTTAACCTTGTATGGTCGCA
>probe:Drosophila_2:1628173_at:77:591; Interrogation_Position=780; Antisense; TGGTCGCAAGTCACACATGATCACT

Paste this into a BLAST search page for me
GGATAACAGCGACGTGGCCACCCTTATCTACCTGCCCCAAATGCGAATAGGGTCACTACAAAATGGTCGGTCGCATTTTGCTGGTGCCTCTGCAGGGAAAGATCTGGACATACTGATGACCACCAGAAGGGCGGCTATACATTTTACAACGGACGTCGGCAAAGTTCGCACCAGATTGGATAACCTCTTCAACGGGCACAACTGCGTCCGCTGGTGGTTGAAACCAGAACGCTACTAGATCTACTCCACATACTCCACAAGACATTTGCCCTGTTTTCCGGCCAGCTTCTTTGTGGAGGAACCTCCTTAACCTTGTATGGTCGCATGGTCGCAAGTCACACATGATCACT

Full Affymetrix probeset data:

Annotations for 1628173_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720