FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628174_at:

>probe:Drosophila_2:1628174_at:176:511; Interrogation_Position=1018; Antisense; GTGAGGGTCAACAGCATTGCCGGAA
>probe:Drosophila_2:1628174_at:190:457; Interrogation_Position=1056; Antisense; GATATCGAGCACTGCAGTTGCCCAT
>probe:Drosophila_2:1628174_at:640:389; Interrogation_Position=1086; Antisense; GAAACCCACTTCATCGATCGCTGTT
>probe:Drosophila_2:1628174_at:95:649; Interrogation_Position=1126; Antisense; TCAGTCAGCATCTCAACACTAGCGA
>probe:Drosophila_2:1628174_at:549:423; Interrogation_Position=1154; Antisense; GAGAAAGCACTTCAATCGCCAACTT
>probe:Drosophila_2:1628174_at:526:523; Interrogation_Position=1203; Antisense; GGGCGTCTATTTAATTTCTGATCCA
>probe:Drosophila_2:1628174_at:668:459; Interrogation_Position=670; Antisense; GATTTGGCAAGTGCGTGGCGCCCAA
>probe:Drosophila_2:1628174_at:681:497; Interrogation_Position=704; Antisense; GTGCTTCGCCGGGTTCATTAAACGG
>probe:Drosophila_2:1628174_at:514:207; Interrogation_Position=748; Antisense; AAGCTGAGTGCTACCTGAACTGCGA
>probe:Drosophila_2:1628174_at:115:65; Interrogation_Position=775; Antisense; ATGGGCTCTGTGAGTCGCGGTACAA
>probe:Drosophila_2:1628174_at:379:665; Interrogation_Position=795; Antisense; TACAAGTGTCACTGCCGCGAAGGAT
>probe:Drosophila_2:1628174_at:293:601; Interrogation_Position=846; Antisense; TGTTTGCCGGAGTGCAGCGACAACT
>probe:Drosophila_2:1628174_at:475:333; Interrogation_Position=913; Antisense; GCTGCTTCCGAGGATACGAGGTCCA
>probe:Drosophila_2:1628174_at:7:13; Interrogation_Position=968; Antisense; ATTCTGCGGCAAATACGGGCGTTGT

Paste this into a BLAST search page for me
GTGAGGGTCAACAGCATTGCCGGAAGATATCGAGCACTGCAGTTGCCCATGAAACCCACTTCATCGATCGCTGTTTCAGTCAGCATCTCAACACTAGCGAGAGAAAGCACTTCAATCGCCAACTTGGGCGTCTATTTAATTTCTGATCCAGATTTGGCAAGTGCGTGGCGCCCAAGTGCTTCGCCGGGTTCATTAAACGGAAGCTGAGTGCTACCTGAACTGCGAATGGGCTCTGTGAGTCGCGGTACAATACAAGTGTCACTGCCGCGAAGGATTGTTTGCCGGAGTGCAGCGACAACTGCTGCTTCCGAGGATACGAGGTCCAATTCTGCGGCAAATACGGGCGTTGT

Full Affymetrix probeset data:

Annotations for 1628174_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720