FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628175_at:

>probe:Drosophila_2:1628175_at:356:177; Interrogation_Position=3142; Antisense; AAACTCGATAAGGTTGCGTGCATCT
>probe:Drosophila_2:1628175_at:539:469; Interrogation_Position=3154; Antisense; GTTGCGTGCATCTAGTTCAGTTCTA
>probe:Drosophila_2:1628175_at:129:255; Interrogation_Position=3187; Antisense; CAACGTGTGCTGTATTTAGTATTTA
>probe:Drosophila_2:1628175_at:181:93; Interrogation_Position=3211; Antisense; AGTTACCTATACCTTACTTAGTGCA
>probe:Drosophila_2:1628175_at:550:147; Interrogation_Position=3226; Antisense; ACTTAGTGCAACGAAACGCTTTTCA
>probe:Drosophila_2:1628175_at:72:389; Interrogation_Position=3258; Antisense; GAAACGCGTCCTTATTTCGACTGAA
>probe:Drosophila_2:1628175_at:85:455; Interrogation_Position=3314; Antisense; GATACGGAGCTTGACTTCTAACCTG
>probe:Drosophila_2:1628175_at:649:619; Interrogation_Position=3337; Antisense; TGCTCATACCTCCACATGCATACAT
>probe:Drosophila_2:1628175_at:300:243; Interrogation_Position=3426; Antisense; AATATCTTTTGAACTGCGGTACGAG
>probe:Drosophila_2:1628175_at:541:705; Interrogation_Position=3455; Antisense; TTACGTACCGATTGATTTAGTTCCA
>probe:Drosophila_2:1628175_at:488:459; Interrogation_Position=3468; Antisense; GATTTAGTTCCATGCTTCACTGAAG
>probe:Drosophila_2:1628175_at:148:33; Interrogation_Position=3519; Antisense; ATCAAGCCTAGGAACTACGTTTCAA
>probe:Drosophila_2:1628175_at:658:215; Interrogation_Position=3570; Antisense; AAGATATTGTTCAGGAAGTCTCCAG
>probe:Drosophila_2:1628175_at:343:373; Interrogation_Position=3584; Antisense; GAAGTCTCCAGTCCTCTAAAGTAAT

Paste this into a BLAST search page for me
AAACTCGATAAGGTTGCGTGCATCTGTTGCGTGCATCTAGTTCAGTTCTACAACGTGTGCTGTATTTAGTATTTAAGTTACCTATACCTTACTTAGTGCAACTTAGTGCAACGAAACGCTTTTCAGAAACGCGTCCTTATTTCGACTGAAGATACGGAGCTTGACTTCTAACCTGTGCTCATACCTCCACATGCATACATAATATCTTTTGAACTGCGGTACGAGTTACGTACCGATTGATTTAGTTCCAGATTTAGTTCCATGCTTCACTGAAGATCAAGCCTAGGAACTACGTTTCAAAAGATATTGTTCAGGAAGTCTCCAGGAAGTCTCCAGTCCTCTAAAGTAAT

Full Affymetrix probeset data:

Annotations for 1628175_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720