FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628177_at:

>probe:Drosophila_2:1628177_at:178:639; Interrogation_Position=445; Antisense; TTGGCCTCCAATCCGGTTTACGAAG
>probe:Drosophila_2:1628177_at:147:85; Interrogation_Position=497; Antisense; AGTGGTCGACTTTTATGCAGGATGT
>probe:Drosophila_2:1628177_at:546:149; Interrogation_Position=540; Antisense; ACTTCACTACAGTCTAAGTCCTGGC
>probe:Drosophila_2:1628177_at:136:505; Interrogation_Position=557; Antisense; GTCCTGGCGAGGAATTCAGTCAGTT
>probe:Drosophila_2:1628177_at:617:381; Interrogation_Position=585; Antisense; GAACGATGTGGGTTTCGTGCAACAC
>probe:Drosophila_2:1628177_at:640:225; Interrogation_Position=673; Antisense; AAGGCCATTTGTCCTTTTCTTGAGC
>probe:Drosophila_2:1628177_at:109:687; Interrogation_Position=688; Antisense; TTTCTTGAGCGAATGCCTGCAGATT
>probe:Drosophila_2:1628177_at:373:613; Interrogation_Position=717; Antisense; TGAACAGTTCCTGGATGACTTCATA
>probe:Drosophila_2:1628177_at:678:475; Interrogation_Position=748; Antisense; GTTATATCCATGAATTTGCAGCAAG
>probe:Drosophila_2:1628177_at:71:455; Interrogation_Position=787; Antisense; GATCAAAAGTTCCTATCTCCCTATA
>probe:Drosophila_2:1628177_at:59:661; Interrogation_Position=810; Antisense; TAAATTGGTGGTGGCCTATGCTCGC
>probe:Drosophila_2:1628177_at:705:275; Interrogation_Position=825; Antisense; CTATGCTCGCAAGACTCCTGAATTT
>probe:Drosophila_2:1628177_at:96:365; Interrogation_Position=852; Antisense; GAATAATGTTTTCCTGGAGCCTACA
>probe:Drosophila_2:1628177_at:27:553; Interrogation_Position=867; Antisense; GGAGCCTACACATCAAAACTTGGTT

Paste this into a BLAST search page for me
TTGGCCTCCAATCCGGTTTACGAAGAGTGGTCGACTTTTATGCAGGATGTACTTCACTACAGTCTAAGTCCTGGCGTCCTGGCGAGGAATTCAGTCAGTTGAACGATGTGGGTTTCGTGCAACACAAGGCCATTTGTCCTTTTCTTGAGCTTTCTTGAGCGAATGCCTGCAGATTTGAACAGTTCCTGGATGACTTCATAGTTATATCCATGAATTTGCAGCAAGGATCAAAAGTTCCTATCTCCCTATATAAATTGGTGGTGGCCTATGCTCGCCTATGCTCGCAAGACTCCTGAATTTGAATAATGTTTTCCTGGAGCCTACAGGAGCCTACACATCAAAACTTGGTT

Full Affymetrix probeset data:

Annotations for 1628177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720