Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628178_a_at:

>probe:Drosophila_2:1628178_a_at:231:485; Interrogation_Position=1042; Antisense; GTATGGGCCAAGGAACTGCTTTCCA
>probe:Drosophila_2:1628178_a_at:329:619; Interrogation_Position=1058; Antisense; TGCTTTCCAAGGACCAGTTCAAGTT
>probe:Drosophila_2:1628178_a_at:270:237; Interrogation_Position=571; Antisense; AATCTCAGTGTCGAAAATGGTGCCA
>probe:Drosophila_2:1628178_a_at:389:229; Interrogation_Position=586; Antisense; AATGGTGCCAATAATGCGGCCCTTC
>probe:Drosophila_2:1628178_a_at:495:469; Interrogation_Position=612; Antisense; GTTCCTCGCTAGACCGCTAAAACTA
>probe:Drosophila_2:1628178_a_at:478:151; Interrogation_Position=644; Antisense; ACATAGGTCTCATTTGTTTGCCGCC
>probe:Drosophila_2:1628178_a_at:11:49; Interrogation_Position=685; Antisense; ATCCATAATCGCTGCATCGTCAGTG
>probe:Drosophila_2:1628178_a_at:694:171; Interrogation_Position=759; Antisense; AAAGATCGAGTTGCCATTGGTGGAC
>probe:Drosophila_2:1628178_a_at:538:69; Interrogation_Position=810; Antisense; AGGACCCTACGGCAAAGACTTCATT
>probe:Drosophila_2:1628178_a_at:529:403; Interrogation_Position=826; Antisense; GACTTCATTCTCGATAACAGCCTAA
>probe:Drosophila_2:1628178_a_at:573:255; Interrogation_Position=885; Antisense; CAAAGGCGATGGAGGTGCCCCACTT
>probe:Drosophila_2:1628178_a_at:696:185; Interrogation_Position=921; Antisense; GCAAAGCGATCCTAACCGGTACGAA
>probe:Drosophila_2:1628178_a_at:155:653; Interrogation_Position=962; Antisense; TCAAAATGAAGTCCACAGCCCGGTT
>probe:Drosophila_2:1628178_a_at:553:223; Interrogation_Position=988; Antisense; AAGGATCTCTCCATAATGTCGTATA

Paste this into a BLAST search page for me
GTATGGGCCAAGGAACTGCTTTCCATGCTTTCCAAGGACCAGTTCAAGTTAATCTCAGTGTCGAAAATGGTGCCAAATGGTGCCAATAATGCGGCCCTTCGTTCCTCGCTAGACCGCTAAAACTAACATAGGTCTCATTTGTTTGCCGCCATCCATAATCGCTGCATCGTCAGTGAAAGATCGAGTTGCCATTGGTGGACAGGACCCTACGGCAAAGACTTCATTGACTTCATTCTCGATAACAGCCTAACAAAGGCGATGGAGGTGCCCCACTTGCAAAGCGATCCTAACCGGTACGAATCAAAATGAAGTCCACAGCCCGGTTAAGGATCTCTCCATAATGTCGTATA

Full Affymetrix probeset data:

Annotations for 1628178_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime