FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628179_at:

>probe:Drosophila_2:1628179_at:662:495; Interrogation_Position=104; Antisense; GTCAGCCTGAGAATTTGGTAGCGAT
>probe:Drosophila_2:1628179_at:447:19; Interrogation_Position=116; Antisense; ATTTGGTAGCGATGGTGCTGCGCCT
>probe:Drosophila_2:1628179_at:253:65; Interrogation_Position=13; Antisense; ATGGACGCGCATTCCACAGCCGTCG
>probe:Drosophila_2:1628179_at:54:317; Interrogation_Position=137; Antisense; GCCTGCAGGCGAACCACGTGTGGAT
>probe:Drosophila_2:1628179_at:312:203; Interrogation_Position=148; Antisense; AACCACGTGTGGATCCGGGAGCAGC
>probe:Drosophila_2:1628179_at:45:529; Interrogation_Position=164; Antisense; GGGAGCAGCTGACTCACCTACAGCG
>probe:Drosophila_2:1628179_at:616:511; Interrogation_Position=196; Antisense; GTGACCCTTCGGCTGGACAAGCAAA
>probe:Drosophila_2:1628179_at:58:223; Interrogation_Position=238; Antisense; AAGGAGCGGTTACAGCGACTCCTGC
>probe:Drosophila_2:1628179_at:662:403; Interrogation_Position=254; Antisense; GACTCCTGCTGAGCTTGCAGGTGAA
>probe:Drosophila_2:1628179_at:90:311; Interrogation_Position=26; Antisense; CCACAGCCGTCGCAGGCATAGATAT
>probe:Drosophila_2:1628179_at:680:721; Interrogation_Position=268; Antisense; TTGCAGGTGAAACACGGACGCCACT
>probe:Drosophila_2:1628179_at:104:153; Interrogation_Position=279; Antisense; ACACGGACGCCACTGGGCACTGTAG
>probe:Drosophila_2:1628179_at:264:67; Interrogation_Position=49; Antisense; ATGGAACTGGACTTCGGCGAGGACA
>probe:Drosophila_2:1628179_at:47:249; Interrogation_Position=89; Antisense; AATTGGAGAAAGTGGGTCAGCCTGA

Paste this into a BLAST search page for me
GTCAGCCTGAGAATTTGGTAGCGATATTTGGTAGCGATGGTGCTGCGCCTATGGACGCGCATTCCACAGCCGTCGGCCTGCAGGCGAACCACGTGTGGATAACCACGTGTGGATCCGGGAGCAGCGGGAGCAGCTGACTCACCTACAGCGGTGACCCTTCGGCTGGACAAGCAAAAAGGAGCGGTTACAGCGACTCCTGCGACTCCTGCTGAGCTTGCAGGTGAACCACAGCCGTCGCAGGCATAGATATTTGCAGGTGAAACACGGACGCCACTACACGGACGCCACTGGGCACTGTAGATGGAACTGGACTTCGGCGAGGACAAATTGGAGAAAGTGGGTCAGCCTGA

Full Affymetrix probeset data:

Annotations for 1628179_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720