FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628180_at:

>probe:Drosophila_2:1628180_at:498:207; Interrogation_Position=445; Antisense; AAGCTCCAGAGCGTCGACAACGTGC
>probe:Drosophila_2:1628180_at:585:197; Interrogation_Position=463; Antisense; AACGTGCCCCGCAAGAAGGCTAAGT
>probe:Drosophila_2:1628180_at:412:149; Interrogation_Position=494; Antisense; ACTTCGTGGGAAACTGCATGCGCAT
>probe:Drosophila_2:1628180_at:681:201; Interrogation_Position=526; Antisense; AACCAGGCCACCCAGGTGTGGGATA
>probe:Drosophila_2:1628180_at:443:77; Interrogation_Position=653; Antisense; AGGTCGAGGAAGAGGCGCCACCCAA
>probe:Drosophila_2:1628180_at:569:435; Interrogation_Position=718; Antisense; GAGGAGACCTCCAACGGCGTGACCA
>probe:Drosophila_2:1628180_at:515:609; Interrogation_Position=737; Antisense; TGACCAGCGACTTTGATTGGGCCGC
>probe:Drosophila_2:1628180_at:703:1; Interrogation_Position=752; Antisense; ATTGGGCCGCCCAGCTAACTAAGAT
>probe:Drosophila_2:1628180_at:647:209; Interrogation_Position=784; Antisense; AAGCAAGCAGATGGCATTTTCCTGG
>probe:Drosophila_2:1628180_at:587:625; Interrogation_Position=840; Antisense; TGCCAAGCATCTGTCCGTCGAGGAT
>probe:Drosophila_2:1628180_at:593:455; Interrogation_Position=904; Antisense; GATAAGCAACTTAAGCTCGCCGATT
>probe:Drosophila_2:1628180_at:373:659; Interrogation_Position=915; Antisense; TAAGCTCGCCGATTCCTTGGAAGTC
>probe:Drosophila_2:1628180_at:171:449; Interrogation_Position=957; Antisense; GATCGCTAGCTAGCCGAATATCCCA
>probe:Drosophila_2:1628180_at:144:365; Interrogation_Position=972; Antisense; GAATATCCCACCTTTAGTCATAGTT

Paste this into a BLAST search page for me
AAGCTCCAGAGCGTCGACAACGTGCAACGTGCCCCGCAAGAAGGCTAAGTACTTCGTGGGAAACTGCATGCGCATAACCAGGCCACCCAGGTGTGGGATAAGGTCGAGGAAGAGGCGCCACCCAAGAGGAGACCTCCAACGGCGTGACCATGACCAGCGACTTTGATTGGGCCGCATTGGGCCGCCCAGCTAACTAAGATAAGCAAGCAGATGGCATTTTCCTGGTGCCAAGCATCTGTCCGTCGAGGATGATAAGCAACTTAAGCTCGCCGATTTAAGCTCGCCGATTCCTTGGAAGTCGATCGCTAGCTAGCCGAATATCCCAGAATATCCCACCTTTAGTCATAGTT

Full Affymetrix probeset data:

Annotations for 1628180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720