FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628184_at:

>probe:Drosophila_2:1628184_at:680:577; Interrogation_Position=1003; Antisense; GGCCGAGCACAATCTGTACGTGATT
>probe:Drosophila_2:1628184_at:97:605; Interrogation_Position=1023; Antisense; TGATTGCCGGCAATGCTCTGGGCAT
>probe:Drosophila_2:1628184_at:236:623; Interrogation_Position=1062; Antisense; TGCTGGTCATCTACTTGGCCAAGAC
>probe:Drosophila_2:1628184_at:493:433; Interrogation_Position=1091; Antisense; GAGGGCCAAATCGAGCTGCAGAAGT
>probe:Drosophila_2:1628184_at:686:353; Interrogation_Position=1170; Antisense; GCACCTGAACATACATACTCTCGGA
>probe:Drosophila_2:1628184_at:260:115; Interrogation_Position=684; Antisense; AGCAGTTCACGCACAAGATCATCCA
>probe:Drosophila_2:1628184_at:421:473; Interrogation_Position=763; Antisense; GTTCAAGTGCTGTGGCCTCAGTAAT
>probe:Drosophila_2:1628184_at:631:63; Interrogation_Position=782; Antisense; AGTAATTCGGGCTACCAGGACTGGA
>probe:Drosophila_2:1628184_at:589:507; Interrogation_Position=850; Antisense; GTGCGGAGTGCCATACAGTTGTTGC
>probe:Drosophila_2:1628184_at:577:467; Interrogation_Position=867; Antisense; GTTGTTGCATCAATGCCACCGACAT
>probe:Drosophila_2:1628184_at:412:35; Interrogation_Position=911; Antisense; ATCATGTGCGGCTACGGCGTTCAAA
>probe:Drosophila_2:1628184_at:505:469; Interrogation_Position=944; Antisense; GTTCCGGAGGCCACGAAACTGATCT
>probe:Drosophila_2:1628184_at:444:263; Interrogation_Position=973; Antisense; CAGCGGCTGCATAGAAATCGTTCGA
>probe:Drosophila_2:1628184_at:451:235; Interrogation_Position=988; Antisense; AATCGTTCGAGTTTGGGCCGAGCAC

Paste this into a BLAST search page for me
GGCCGAGCACAATCTGTACGTGATTTGATTGCCGGCAATGCTCTGGGCATTGCTGGTCATCTACTTGGCCAAGACGAGGGCCAAATCGAGCTGCAGAAGTGCACCTGAACATACATACTCTCGGAAGCAGTTCACGCACAAGATCATCCAGTTCAAGTGCTGTGGCCTCAGTAATAGTAATTCGGGCTACCAGGACTGGAGTGCGGAGTGCCATACAGTTGTTGCGTTGTTGCATCAATGCCACCGACATATCATGTGCGGCTACGGCGTTCAAAGTTCCGGAGGCCACGAAACTGATCTCAGCGGCTGCATAGAAATCGTTCGAAATCGTTCGAGTTTGGGCCGAGCAC

Full Affymetrix probeset data:

Annotations for 1628184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720