Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628185_at:

>probe:Drosophila_2:1628185_at:699:193; Interrogation_Position=1345; Antisense; AACTCGAAGCTCTATGCCACCTGTT
>probe:Drosophila_2:1628185_at:401:231; Interrogation_Position=1432; Antisense; AATGTTCGGTATGCCTGCAATGTCT
>probe:Drosophila_2:1628185_at:722:623; Interrogation_Position=1487; Antisense; TGCGCAAGCACGTTAGCTACCGACA
>probe:Drosophila_2:1628185_at:315:521; Interrogation_Position=1517; Antisense; GGGCGCCATCGCCATGTGAAAACGA
>probe:Drosophila_2:1628185_at:695:213; Interrogation_Position=1552; Antisense; AAGAGGGTCTCCAAGCTAGCAGCGA
>probe:Drosophila_2:1628185_at:285:89; Interrogation_Position=1615; Antisense; AGTCACACGGTCACCAGTGGCGATG
>probe:Drosophila_2:1628185_at:603:267; Interrogation_Position=1629; Antisense; CAGTGGCGATGTGGGTCCAGCTCCA
>probe:Drosophila_2:1628185_at:215:123; Interrogation_Position=1653; Antisense; AGCGACCACACTTGGATGTTCGGGT
>probe:Drosophila_2:1628185_at:571:563; Interrogation_Position=1683; Antisense; GGCAAGGAATCCGTACCTTTTCCTG
>probe:Drosophila_2:1628185_at:698:275; Interrogation_Position=1699; Antisense; CTTTTCCTGCCCAATCAATTTCAGA
>probe:Drosophila_2:1628185_at:616:651; Interrogation_Position=1713; Antisense; TCAATTTCAGATGGCTGCTGCTGCA
>probe:Drosophila_2:1628185_at:686:713; Interrogation_Position=1770; Antisense; TTCTGGTCAACCATCGCTAGACTTG
>probe:Drosophila_2:1628185_at:296:379; Interrogation_Position=1801; Antisense; GAAGCGCCACCGAGCATCAAAAGTG
>probe:Drosophila_2:1628185_at:144:497; Interrogation_Position=1865; Antisense; GTGTAGAGGCATCGGCGTCAACCAC

Paste this into a BLAST search page for me
AACTCGAAGCTCTATGCCACCTGTTAATGTTCGGTATGCCTGCAATGTCTTGCGCAAGCACGTTAGCTACCGACAGGGCGCCATCGCCATGTGAAAACGAAAGAGGGTCTCCAAGCTAGCAGCGAAGTCACACGGTCACCAGTGGCGATGCAGTGGCGATGTGGGTCCAGCTCCAAGCGACCACACTTGGATGTTCGGGTGGCAAGGAATCCGTACCTTTTCCTGCTTTTCCTGCCCAATCAATTTCAGATCAATTTCAGATGGCTGCTGCTGCATTCTGGTCAACCATCGCTAGACTTGGAAGCGCCACCGAGCATCAAAAGTGGTGTAGAGGCATCGGCGTCAACCAC

Full Affymetrix probeset data:

Annotations for 1628185_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime