FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628186_at:

>probe:Drosophila_2:1628186_at:136:397; Interrogation_Position=120; Antisense; GACAAGGACAACGAGGGCGCCATAA
>probe:Drosophila_2:1628186_at:680:433; Interrogation_Position=132; Antisense; GAGGGCGCCATAACATCTAAAGAGA
>probe:Drosophila_2:1628186_at:39:81; Interrogation_Position=235; Antisense; AGGGAAACGGATCCATCGTGGCTCC
>probe:Drosophila_2:1628186_at:172:215; Interrogation_Position=285; Antisense; AAGATGCGCGACACCAACCATGAGG
>probe:Drosophila_2:1628186_at:658:253; Interrogation_Position=299; Antisense; CAACCATGAGGACGAGCTGCGCGAA
>probe:Drosophila_2:1628186_at:716:335; Interrogation_Position=314; Antisense; GCTGCGCGAAGCTTTCCGAATTTTC
>probe:Drosophila_2:1628186_at:105:659; Interrogation_Position=347; Antisense; TAACAATGGCTACATTACCACCACC
>probe:Drosophila_2:1628186_at:108:707; Interrogation_Position=361; Antisense; TTACCACCACCGAGCTAAAAAATGT
>probe:Drosophila_2:1628186_at:417:181; Interrogation_Position=377; Antisense; AAAAAATGTGTTCACCGCGCTGGGC
>probe:Drosophila_2:1628186_at:551:299; Interrogation_Position=438; Antisense; CGCGAGTACGACTTGGATCAGGACA
>probe:Drosophila_2:1628186_at:406:445; Interrogation_Position=494; Antisense; GATGACAATGCGATAGCCTCCATGT
>probe:Drosophila_2:1628186_at:585:325; Interrogation_Position=503; Antisense; GCGATAGCCTCCATGTGAGTACTCG
>probe:Drosophila_2:1628186_at:621:57; Interrogation_Position=79; Antisense; ATGAGGAGCGAGTCCTGATCCTTGA
>probe:Drosophila_2:1628186_at:446:605; Interrogation_Position=94; Antisense; TGATCCTTGACACTTTCCGTATTTT

Paste this into a BLAST search page for me
GACAAGGACAACGAGGGCGCCATAAGAGGGCGCCATAACATCTAAAGAGAAGGGAAACGGATCCATCGTGGCTCCAAGATGCGCGACACCAACCATGAGGCAACCATGAGGACGAGCTGCGCGAAGCTGCGCGAAGCTTTCCGAATTTTCTAACAATGGCTACATTACCACCACCTTACCACCACCGAGCTAAAAAATGTAAAAAATGTGTTCACCGCGCTGGGCCGCGAGTACGACTTGGATCAGGACAGATGACAATGCGATAGCCTCCATGTGCGATAGCCTCCATGTGAGTACTCGATGAGGAGCGAGTCCTGATCCTTGATGATCCTTGACACTTTCCGTATTTT

Full Affymetrix probeset data:

Annotations for 1628186_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720