Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628187_s_at:

>probe:Drosophila_2:1628187_s_at:267:465; Interrogation_Position=104; Antisense; GATTGGTCCTGCTTATGGCCGCTGG
>probe:Drosophila_2:1628187_s_at:235:575; Interrogation_Position=126; Antisense; TGGCCAAGTTCGTGCCGAGTGCGAC
>probe:Drosophila_2:1628187_s_at:199:291; Interrogation_Position=141; Antisense; CGAGTGCGACGAGGCCAAGAGTCCC
>probe:Drosophila_2:1628187_s_at:201:559; Interrogation_Position=168; Antisense; GGACAGCGAATTCAAGCACTTCTTC
>probe:Drosophila_2:1628187_s_at:613:149; Interrogation_Position=185; Antisense; ACTTCTTCAAGAACCTAGGCTGCAA
>probe:Drosophila_2:1628187_s_at:498:643; Interrogation_Position=22; Antisense; TCTCGGAGCGGAGCGATCAGTCAGT
>probe:Drosophila_2:1628187_s_at:248:725; Interrogation_Position=287; Antisense; TTGGCAGCTCGGTGGCCCAGAAGTA
>probe:Drosophila_2:1628187_s_at:252:383; Interrogation_Position=316; Antisense; GAACTGAAGCACAAGCTGACCGATG
>probe:Drosophila_2:1628187_s_at:154:135; Interrogation_Position=352; Antisense; ACGCCCAAAATTCCAGTGGCCTATG
>probe:Drosophila_2:1628187_s_at:328:267; Interrogation_Position=39; Antisense; CAGTCAGTCGCGTTGTCAAGCTGAA
>probe:Drosophila_2:1628187_s_at:428:701; Interrogation_Position=443; Antisense; TTTTGCAATCGCTTGAAGGTCCCCT
>probe:Drosophila_2:1628187_s_at:2:281; Interrogation_Position=466; Antisense; CTCCGTCTCGTTGCATAAGTTTTCT
>probe:Drosophila_2:1628187_s_at:596:55; Interrogation_Position=73; Antisense; ATGAAATCGCTCGTTGTGTGCTCTT
>probe:Drosophila_2:1628187_s_at:498:597; Interrogation_Position=89; Antisense; TGTGCTCTTTGATCGGATTGGTCCT

Paste this into a BLAST search page for me
GATTGGTCCTGCTTATGGCCGCTGGTGGCCAAGTTCGTGCCGAGTGCGACCGAGTGCGACGAGGCCAAGAGTCCCGGACAGCGAATTCAAGCACTTCTTCACTTCTTCAAGAACCTAGGCTGCAATCTCGGAGCGGAGCGATCAGTCAGTTTGGCAGCTCGGTGGCCCAGAAGTAGAACTGAAGCACAAGCTGACCGATGACGCCCAAAATTCCAGTGGCCTATGCAGTCAGTCGCGTTGTCAAGCTGAATTTTGCAATCGCTTGAAGGTCCCCTCTCCGTCTCGTTGCATAAGTTTTCTATGAAATCGCTCGTTGTGTGCTCTTTGTGCTCTTTGATCGGATTGGTCCT

Full Affymetrix probeset data:

Annotations for 1628187_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime