Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628188_at:

>probe:Drosophila_2:1628188_at:5:275; Interrogation_Position=13; Antisense; CTTGGAATACTGCTCAGAGGACAAA
>probe:Drosophila_2:1628188_at:491:35; Interrogation_Position=134; Antisense; ATCATTGAATGCCACAGGAATCTTA
>probe:Drosophila_2:1628188_at:584:213; Interrogation_Position=160; Antisense; AAGATGTGCTTTTGGCGACTTTCCA
>probe:Drosophila_2:1628188_at:361:701; Interrogation_Position=169; Antisense; TTTTGGCGACTTTCCACTGACTGTT
>probe:Drosophila_2:1628188_at:489:147; Interrogation_Position=177; Antisense; ACTTTCCACTGACTGTTCCAATTGA
>probe:Drosophila_2:1628188_at:652:403; Interrogation_Position=187; Antisense; GACTGTTCCAATTGAGTTCCATTTT
>probe:Drosophila_2:1628188_at:300:607; Interrogation_Position=199; Antisense; TGAGTTCCATTTTATGCCCTTTTTT
>probe:Drosophila_2:1628188_at:171:669; Interrogation_Position=20; Antisense; TACTGCTCAGAGGACAAAGCGGGAG
>probe:Drosophila_2:1628188_at:432:683; Interrogation_Position=211; Antisense; TATGCCCTTTTTTAGGTACAACACT
>probe:Drosophila_2:1628188_at:50:705; Interrogation_Position=222; Antisense; TTAGGTACAACACTGCCCAAGACAT
>probe:Drosophila_2:1628188_at:679:159; Interrogation_Position=228; Antisense; ACAACACTGCCCAAGACATCATATA
>probe:Drosophila_2:1628188_at:305:157; Interrogation_Position=33; Antisense; ACAAAGCGGGAGTGACGGAAGATAC
>probe:Drosophila_2:1628188_at:239:135; Interrogation_Position=47; Antisense; ACGGAAGATACGATCGGCGGAACGA
>probe:Drosophila_2:1628188_at:588:175; Interrogation_Position=79; Antisense; AAACGTGCTTCGAATAAACATAGGA

Paste this into a BLAST search page for me
CTTGGAATACTGCTCAGAGGACAAAATCATTGAATGCCACAGGAATCTTAAAGATGTGCTTTTGGCGACTTTCCATTTTGGCGACTTTCCACTGACTGTTACTTTCCACTGACTGTTCCAATTGAGACTGTTCCAATTGAGTTCCATTTTTGAGTTCCATTTTATGCCCTTTTTTTACTGCTCAGAGGACAAAGCGGGAGTATGCCCTTTTTTAGGTACAACACTTTAGGTACAACACTGCCCAAGACATACAACACTGCCCAAGACATCATATAACAAAGCGGGAGTGACGGAAGATACACGGAAGATACGATCGGCGGAACGAAAACGTGCTTCGAATAAACATAGGA

Full Affymetrix probeset data:

Annotations for 1628188_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime