Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628190_at:

>probe:Drosophila_2:1628190_at:260:465; Interrogation_Position=6630; Antisense; GTTGGCGTGCGAAAACTGGCTAACT
>probe:Drosophila_2:1628190_at:247:583; Interrogation_Position=6646; Antisense; TGGCTAACTTCTTGGTGGCGCGCAC
>probe:Drosophila_2:1628190_at:192:311; Interrogation_Position=6672; Antisense; GCCACCATTCAGTTCGGATTTACGA
>probe:Drosophila_2:1628190_at:15:637; Interrogation_Position=6685; Antisense; TCGGATTTACGATCTGAGCGGTCAA
>probe:Drosophila_2:1628190_at:530:325; Interrogation_Position=6721; Antisense; GCGAGCTGCGCTTAAATGGCGCCAT
>probe:Drosophila_2:1628190_at:469:169; Interrogation_Position=6734; Antisense; AAATGGCGCCATTTGCGGTTCGGTG
>probe:Drosophila_2:1628190_at:430:407; Interrogation_Position=6769; Antisense; GACTGGACTACTGGACTAGTGGTCA
>probe:Drosophila_2:1628190_at:448:679; Interrogation_Position=6785; Antisense; TAGTGGTCAGCCACTGGCCAAGGGT
>probe:Drosophila_2:1628190_at:260:517; Interrogation_Position=6808; Antisense; GTGTGCCGCAACATGAGTGCCAGCT
>probe:Drosophila_2:1628190_at:177:433; Interrogation_Position=6822; Antisense; GAGTGCCAGCTACAAAGTTTTCCCA
>probe:Drosophila_2:1628190_at:16:171; Interrogation_Position=6835; Antisense; AAAGTTTTCCCACTGCACGGAGACT
>probe:Drosophila_2:1628190_at:311:67; Interrogation_Position=6910; Antisense; ATGGCAATTGCCTACGACTGGAAGA
>probe:Drosophila_2:1628190_at:714:481; Interrogation_Position=7061; Antisense; GTATTCCTTCGAAAGTTTTCCTGCA
>probe:Drosophila_2:1628190_at:593:559; Interrogation_Position=7094; Antisense; GGAAATATTCTGACCCCATTGTTTT

Paste this into a BLAST search page for me
GTTGGCGTGCGAAAACTGGCTAACTTGGCTAACTTCTTGGTGGCGCGCACGCCACCATTCAGTTCGGATTTACGATCGGATTTACGATCTGAGCGGTCAAGCGAGCTGCGCTTAAATGGCGCCATAAATGGCGCCATTTGCGGTTCGGTGGACTGGACTACTGGACTAGTGGTCATAGTGGTCAGCCACTGGCCAAGGGTGTGTGCCGCAACATGAGTGCCAGCTGAGTGCCAGCTACAAAGTTTTCCCAAAAGTTTTCCCACTGCACGGAGACTATGGCAATTGCCTACGACTGGAAGAGTATTCCTTCGAAAGTTTTCCTGCAGGAAATATTCTGACCCCATTGTTTT

Full Affymetrix probeset data:

Annotations for 1628190_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime