FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628191_at:

>probe:Drosophila_2:1628191_at:426:209; Interrogation_Position=1018; Antisense; AAGAATCCGAGCCTTTCAGCCGGAG
>probe:Drosophila_2:1628191_at:75:343; Interrogation_Position=1042; Antisense; GCATAAGGGTTTTGGCCTAGCTGCC
>probe:Drosophila_2:1628191_at:370:119; Interrogation_Position=1060; Antisense; AGCTGCCGCAGTGGATATTCTGTGC
>probe:Drosophila_2:1628191_at:452:683; Interrogation_Position=1106; Antisense; TATGCAAATCAAATCCAGCGTCGTG
>probe:Drosophila_2:1628191_at:254:115; Interrogation_Position=1122; Antisense; AGCGTCGTGGCGTCTATAGTACGGA
>probe:Drosophila_2:1628191_at:296:185; Interrogation_Position=1146; Antisense; AAAATGCTCCGGCTAATCTGGGCCA
>probe:Drosophila_2:1628191_at:407:637; Interrogation_Position=1185; Antisense; TCGATCCGATGCGTTTTTGTCCCAC
>probe:Drosophila_2:1628191_at:3:131; Interrogation_Position=1208; Antisense; ACCTTCGAGGACAGATTGGCCGATT
>probe:Drosophila_2:1628191_at:598:459; Interrogation_Position=1229; Antisense; GATTTCCACCGGCTGTTGAGACAAG
>probe:Drosophila_2:1628191_at:94:725; Interrogation_Position=1244; Antisense; TTGAGACAAGCGGTGCCCAGCAAGG
>probe:Drosophila_2:1628191_at:184:175; Interrogation_Position=1274; Antisense; AAACCACCGATGGTGCCGGGTGACA
>probe:Drosophila_2:1628191_at:449:631; Interrogation_Position=1352; Antisense; TCCTGTACTCTGTCAGTTCTGGAAG
>probe:Drosophila_2:1628191_at:707:141; Interrogation_Position=1378; Antisense; ACTGGCCACAGAGTTTGACATCGAA
>probe:Drosophila_2:1628191_at:423:579; Interrogation_Position=1476; Antisense; TGGCCAAGTCTTGTTTAGCTTTTGT

Paste this into a BLAST search page for me
AAGAATCCGAGCCTTTCAGCCGGAGGCATAAGGGTTTTGGCCTAGCTGCCAGCTGCCGCAGTGGATATTCTGTGCTATGCAAATCAAATCCAGCGTCGTGAGCGTCGTGGCGTCTATAGTACGGAAAAATGCTCCGGCTAATCTGGGCCATCGATCCGATGCGTTTTTGTCCCACACCTTCGAGGACAGATTGGCCGATTGATTTCCACCGGCTGTTGAGACAAGTTGAGACAAGCGGTGCCCAGCAAGGAAACCACCGATGGTGCCGGGTGACATCCTGTACTCTGTCAGTTCTGGAAGACTGGCCACAGAGTTTGACATCGAATGGCCAAGTCTTGTTTAGCTTTTGT

Full Affymetrix probeset data:

Annotations for 1628191_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720