FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628192_at:

>probe:Drosophila_2:1628192_at:169:287; Interrogation_Position=1980; Antisense; CGGCGAGGTCGATGATATGTACAAT
>probe:Drosophila_2:1628192_at:81:261; Interrogation_Position=2064; Antisense; CACCCCGCTTCAAAGGACAACAGAA
>probe:Drosophila_2:1628192_at:175:697; Interrogation_Position=2163; Antisense; TTTCGACTACTCACGCATGGAGTAT
>probe:Drosophila_2:1628192_at:622:549; Interrogation_Position=2181; Antisense; GGAGTATAGTTTCAGCAACGGCGTA
>probe:Drosophila_2:1628192_at:51:197; Interrogation_Position=2197; Antisense; AACGGCGTAGTCACCCAGAGTTTGC
>probe:Drosophila_2:1628192_at:42:573; Interrogation_Position=2266; Antisense; GGCGGCGGAACCATCAATTTCGACA
>probe:Drosophila_2:1628192_at:180:189; Interrogation_Position=2299; Antisense; AACATCATCTACTCCACCATGGAAC
>probe:Drosophila_2:1628192_at:262:67; Interrogation_Position=2317; Antisense; ATGGAACTCGAGTGCATGCCAGGAT
>probe:Drosophila_2:1628192_at:402:49; Interrogation_Position=2332; Antisense; ATGCCAGGATACGACGGCGGACTGC
>probe:Drosophila_2:1628192_at:543:575; Interrogation_Position=2376; Antisense; GGCCTACGACTCCAAGACCATGAAG
>probe:Drosophila_2:1628192_at:105:571; Interrogation_Position=2405; Antisense; GGCTTAACATGAGCAGCACCTACAT
>probe:Drosophila_2:1628192_at:672:497; Interrogation_Position=2440; Antisense; GTCTTCCGGATCGATCTATCAGGTG
>probe:Drosophila_2:1628192_at:171:517; Interrogation_Position=2466; Antisense; GTGTGTCTACCTTATCAACTATCCA
>probe:Drosophila_2:1628192_at:233:191; Interrogation_Position=2482; Antisense; AACTATCCACCTGATTTGTTTCAAG

Paste this into a BLAST search page for me
CGGCGAGGTCGATGATATGTACAATCACCCCGCTTCAAAGGACAACAGAATTTCGACTACTCACGCATGGAGTATGGAGTATAGTTTCAGCAACGGCGTAAACGGCGTAGTCACCCAGAGTTTGCGGCGGCGGAACCATCAATTTCGACAAACATCATCTACTCCACCATGGAACATGGAACTCGAGTGCATGCCAGGATATGCCAGGATACGACGGCGGACTGCGGCCTACGACTCCAAGACCATGAAGGGCTTAACATGAGCAGCACCTACATGTCTTCCGGATCGATCTATCAGGTGGTGTGTCTACCTTATCAACTATCCAAACTATCCACCTGATTTGTTTCAAG

Full Affymetrix probeset data:

Annotations for 1628192_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720