Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628193_s_at:

>probe:Drosophila_2:1628193_s_at:600:331; Interrogation_Position=555; Antisense; GCGGCAATTGACATTGATCAGAGCT
>probe:Drosophila_2:1628193_s_at:375:605; Interrogation_Position=569; Antisense; TGATCAGAGCTGACCTTAACGGAGT
>probe:Drosophila_2:1628193_s_at:538:309; Interrogation_Position=630; Antisense; CCACCGGTCACTTAATGCGCTTAAA
>probe:Drosophila_2:1628193_s_at:284:233; Interrogation_Position=643; Antisense; AATGCGCTTAAAACGAGACACAATG
>probe:Drosophila_2:1628193_s_at:395:563; Interrogation_Position=700; Antisense; GGAATCCCCTCATCATTATGCAGAT
>probe:Drosophila_2:1628193_s_at:433:289; Interrogation_Position=732; Antisense; CGGAATGTTCCCTAGAGGCATGCAA
>probe:Drosophila_2:1628193_s_at:190:171; Interrogation_Position=768; Antisense; AAAGTGCGCCTACGACAAGAGTCTA
>probe:Drosophila_2:1628193_s_at:648:477; Interrogation_Position=824; Antisense; GTTTCCAGGGTACTCAATTAGTCGA
>probe:Drosophila_2:1628193_s_at:420:247; Interrogation_Position=838; Antisense; CAATTAGTCGAGTTCTTCCTTGGTT
>probe:Drosophila_2:1628193_s_at:521:729; Interrogation_Position=857; Antisense; TTGGTTTTTATGTCTGCATCCTGGC
>probe:Drosophila_2:1628193_s_at:413:47; Interrogation_Position=874; Antisense; ATCCTGGCTGCTGTTGTAGTTGTCT
>probe:Drosophila_2:1628193_s_at:676:497; Interrogation_Position=895; Antisense; GTCTTTTTTGTTTCTTGCTCTGCGC
>probe:Drosophila_2:1628193_s_at:635:619; Interrogation_Position=910; Antisense; TGCTCTGCGCTAAGCTTCACTAAAT
>probe:Drosophila_2:1628193_s_at:541:663; Interrogation_Position=930; Antisense; TAAATCCTTCTGTCGCGTCGAAAGC

Paste this into a BLAST search page for me
GCGGCAATTGACATTGATCAGAGCTTGATCAGAGCTGACCTTAACGGAGTCCACCGGTCACTTAATGCGCTTAAAAATGCGCTTAAAACGAGACACAATGGGAATCCCCTCATCATTATGCAGATCGGAATGTTCCCTAGAGGCATGCAAAAAGTGCGCCTACGACAAGAGTCTAGTTTCCAGGGTACTCAATTAGTCGACAATTAGTCGAGTTCTTCCTTGGTTTTGGTTTTTATGTCTGCATCCTGGCATCCTGGCTGCTGTTGTAGTTGTCTGTCTTTTTTGTTTCTTGCTCTGCGCTGCTCTGCGCTAAGCTTCACTAAATTAAATCCTTCTGTCGCGTCGAAAGC

Full Affymetrix probeset data:

Annotations for 1628193_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime