Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628194_at:

>probe:Drosophila_2:1628194_at:187:95; Interrogation_Position=2675; Antisense; AGTTGGCCAAGAACGCGGATATCCG
>probe:Drosophila_2:1628194_at:303:543; Interrogation_Position=2691; Antisense; GGATATCCGCCTGACCGTCAAGGAT
>probe:Drosophila_2:1628194_at:441:159; Interrogation_Position=2723; Antisense; ACAAAATGAGCCTGCTGGACCGCGA
>probe:Drosophila_2:1628194_at:410:411; Interrogation_Position=2740; Antisense; GACCGCGAGGTCAAGTACTTGGTTA
>probe:Drosophila_2:1628194_at:700:583; Interrogation_Position=2779; Antisense; TGGAAGCCCAAGGTGAAGCCCGCTG
>probe:Drosophila_2:1628194_at:292:205; Interrogation_Position=2794; Antisense; AAGCCCGCTGCTGAAAAGGAGAAGA
>probe:Drosophila_2:1628194_at:243:445; Interrogation_Position=2854; Antisense; GATGACACCAAATCGGAGGACGCCG
>probe:Drosophila_2:1628194_at:577:419; Interrogation_Position=2917; Antisense; GAGCAGGAGCCCGTAGATGAGATCA
>probe:Drosophila_2:1628194_at:129:487; Interrogation_Position=2929; Antisense; GTAGATGAGATCACTCCAACGCCTG
>probe:Drosophila_2:1628194_at:282:547; Interrogation_Position=2958; Antisense; GGAGGAAACCAAGACACCGCACAGT
>probe:Drosophila_2:1628194_at:325:399; Interrogation_Position=2970; Antisense; GACACCGCACAGTGAGCTCTAAGGA
>probe:Drosophila_2:1628194_at:374:543; Interrogation_Position=3007; Antisense; GGATTACGAGCATCCGTAGCAGCAG
>probe:Drosophila_2:1628194_at:249:73; Interrogation_Position=3030; Antisense; AGGAAGCCAAGTGCCTGTCTTAGGA
>probe:Drosophila_2:1628194_at:540:523; Interrogation_Position=3119; Antisense; GGGCGTCTTTATTTCTATGATTTTT

Paste this into a BLAST search page for me
AGTTGGCCAAGAACGCGGATATCCGGGATATCCGCCTGACCGTCAAGGATACAAAATGAGCCTGCTGGACCGCGAGACCGCGAGGTCAAGTACTTGGTTATGGAAGCCCAAGGTGAAGCCCGCTGAAGCCCGCTGCTGAAAAGGAGAAGAGATGACACCAAATCGGAGGACGCCGGAGCAGGAGCCCGTAGATGAGATCAGTAGATGAGATCACTCCAACGCCTGGGAGGAAACCAAGACACCGCACAGTGACACCGCACAGTGAGCTCTAAGGAGGATTACGAGCATCCGTAGCAGCAGAGGAAGCCAAGTGCCTGTCTTAGGAGGGCGTCTTTATTTCTATGATTTTT

Full Affymetrix probeset data:

Annotations for 1628194_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime