FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628197_at:

>probe:Drosophila_2:1628197_at:396:547; Interrogation_Position=116; Antisense; GGAGGTGGCTACAAGTACGGCGGAT
>probe:Drosophila_2:1628197_at:107:719; Interrogation_Position=13; Antisense; TTGGCAGGACAAGAAACCCGCTGAG
>probe:Drosophila_2:1628197_at:183:671; Interrogation_Position=131; Antisense; TACGGCGGATATTCCGGTTACGGCG
>probe:Drosophila_2:1628197_at:112:459; Interrogation_Position=138; Antisense; GATATTCCGGTTACGGCGGCTACGG
>probe:Drosophila_2:1628197_at:6:571; Interrogation_Position=155; Antisense; GGCTACGGCGGATATCGCTCCTACG
>probe:Drosophila_2:1628197_at:484:457; Interrogation_Position=165; Antisense; GATATCGCTCCTACGGAGGCGGATT
>probe:Drosophila_2:1628197_at:182:547; Interrogation_Position=179; Antisense; GGAGGCGGATTCTATCGTCCCCGAA
>probe:Drosophila_2:1628197_at:705:329; Interrogation_Position=183; Antisense; GCGGATTCTATCGTCCCCGAATTTA
>probe:Drosophila_2:1628197_at:114:177; Interrogation_Position=26; Antisense; AAACCCGCTGAGGAGGCTGATCTCT
>probe:Drosophila_2:1628197_at:257:77; Interrogation_Position=36; Antisense; AGGAGGCTGATCTCTCCACCGCGGA
>probe:Drosophila_2:1628197_at:438:551; Interrogation_Position=58; Antisense; GGACTCCATTGGCTACGGCTACTAT
>probe:Drosophila_2:1628197_at:594:3; Interrogation_Position=65; Antisense; ATTGGCTACGGCTACTATGCAGCTC
>probe:Drosophila_2:1628197_at:350:681; Interrogation_Position=80; Antisense; TATGCAGCTCCATCGCCAATTTACT
>probe:Drosophila_2:1628197_at:535:45; Interrogation_Position=91; Antisense; ATCGCCAATTTACTACGGCGGCTAT

Paste this into a BLAST search page for me
GGAGGTGGCTACAAGTACGGCGGATTTGGCAGGACAAGAAACCCGCTGAGTACGGCGGATATTCCGGTTACGGCGGATATTCCGGTTACGGCGGCTACGGGGCTACGGCGGATATCGCTCCTACGGATATCGCTCCTACGGAGGCGGATTGGAGGCGGATTCTATCGTCCCCGAAGCGGATTCTATCGTCCCCGAATTTAAAACCCGCTGAGGAGGCTGATCTCTAGGAGGCTGATCTCTCCACCGCGGAGGACTCCATTGGCTACGGCTACTATATTGGCTACGGCTACTATGCAGCTCTATGCAGCTCCATCGCCAATTTACTATCGCCAATTTACTACGGCGGCTAT

Full Affymetrix probeset data:

Annotations for 1628197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720