Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628198_at:

>probe:Drosophila_2:1628198_at:412:107; Interrogation_Position=2350; Antisense; AGAAAGCCGCAAACGATCATCCACG
>probe:Drosophila_2:1628198_at:6:321; Interrogation_Position=2374; Antisense; GCCCGCCAGTGATGACAGTGCCGAT
>probe:Drosophila_2:1628198_at:456:437; Interrogation_Position=2399; Antisense; GAGGACTTCCGTGGATTCTAGCAAT
>probe:Drosophila_2:1628198_at:194:481; Interrogation_Position=2425; Antisense; GTTTGCAGTTTATTGTTTCTCGAAT
>probe:Drosophila_2:1628198_at:644:717; Interrogation_Position=2450; Antisense; TTCCTTTTTCTTCGCACTTAAGTCT
>probe:Drosophila_2:1628198_at:289:93; Interrogation_Position=2482; Antisense; AGATAACTTTTTCTGGCTTCCTTTG
>probe:Drosophila_2:1628198_at:46:571; Interrogation_Position=2496; Antisense; GGCTTCCTTTGCAATCCTAACAAGT
>probe:Drosophila_2:1628198_at:271:371; Interrogation_Position=2577; Antisense; GAAGGCTTCTATAAACTAATCTGGC
>probe:Drosophila_2:1628198_at:231:243; Interrogation_Position=2653; Antisense; AATTTCTATACTCTTAACTGGCCGC
>probe:Drosophila_2:1628198_at:527:659; Interrogation_Position=2667; Antisense; TAACTGGCCGCCAATCGGGCAAAGT
>probe:Drosophila_2:1628198_at:142:517; Interrogation_Position=2747; Antisense; GTGTGTATTCACTTGCTTAAGCGCA
>probe:Drosophila_2:1628198_at:282:279; Interrogation_Position=2814; Antisense; CTAGCACGTTATTCTCTGCACATAA
>probe:Drosophila_2:1628198_at:515:691; Interrogation_Position=2846; Antisense; TTTGGCGTATAGCAACGTCCGGATT
>probe:Drosophila_2:1628198_at:3:501; Interrogation_Position=2862; Antisense; GTCCGGATTAAAACCCTGTCAGATA

Paste this into a BLAST search page for me
AGAAAGCCGCAAACGATCATCCACGGCCCGCCAGTGATGACAGTGCCGATGAGGACTTCCGTGGATTCTAGCAATGTTTGCAGTTTATTGTTTCTCGAATTTCCTTTTTCTTCGCACTTAAGTCTAGATAACTTTTTCTGGCTTCCTTTGGGCTTCCTTTGCAATCCTAACAAGTGAAGGCTTCTATAAACTAATCTGGCAATTTCTATACTCTTAACTGGCCGCTAACTGGCCGCCAATCGGGCAAAGTGTGTGTATTCACTTGCTTAAGCGCACTAGCACGTTATTCTCTGCACATAATTTGGCGTATAGCAACGTCCGGATTGTCCGGATTAAAACCCTGTCAGATA

Full Affymetrix probeset data:

Annotations for 1628198_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime