FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628199_at:

>probe:Drosophila_2:1628199_at:422:403; Interrogation_Position=1005; Antisense; GACTATTGTAGCTACTTAACTCTGC
>probe:Drosophila_2:1628199_at:118:339; Interrogation_Position=1015; Antisense; GCTACTTAACTCTGCTTTTCGAGGA
>probe:Drosophila_2:1628199_at:657:405; Interrogation_Position=504; Antisense; GACTGAAGTGCATCAGCCAGAGCAA
>probe:Drosophila_2:1628199_at:28:433; Interrogation_Position=529; Antisense; GAGTCCACCGAGGATGAGCGATTCC
>probe:Drosophila_2:1628199_at:621:415; Interrogation_Position=544; Antisense; GAGCGATTCCAATGCCACGTCAAGA
>probe:Drosophila_2:1628199_at:67:313; Interrogation_Position=557; Antisense; GCCACGTCAAGAATGAGTCCATCAA
>probe:Drosophila_2:1628199_at:483:505; Interrogation_Position=573; Antisense; GTCCATCAACGAAGATCTCTCAGAG
>probe:Drosophila_2:1628199_at:341:325; Interrogation_Position=611; Antisense; GCGAACTGAGCACATTAAGACTGGA
>probe:Drosophila_2:1628199_at:162:111; Interrogation_Position=647; Antisense; AGAATGTCCTCGAAGGTACTCCTCG
>probe:Drosophila_2:1628199_at:534:489; Interrogation_Position=662; Antisense; GTACTCCTCGAATCGTTGAGATGCA
>probe:Drosophila_2:1628199_at:121:493; Interrogation_Position=892; Antisense; GTAACTGCTCATGTCTGCGATTATT
>probe:Drosophila_2:1628199_at:592:459; Interrogation_Position=910; Antisense; GATTATTACTGACTTCTTTCTGTGA
>probe:Drosophila_2:1628199_at:78:487; Interrogation_Position=977; Antisense; GTAGTTTGTTTTGAACTCGCATCGA
>probe:Drosophila_2:1628199_at:120:385; Interrogation_Position=989; Antisense; GAACTCGCATCGAAACGACTATTGT

Paste this into a BLAST search page for me
GACTATTGTAGCTACTTAACTCTGCGCTACTTAACTCTGCTTTTCGAGGAGACTGAAGTGCATCAGCCAGAGCAAGAGTCCACCGAGGATGAGCGATTCCGAGCGATTCCAATGCCACGTCAAGAGCCACGTCAAGAATGAGTCCATCAAGTCCATCAACGAAGATCTCTCAGAGGCGAACTGAGCACATTAAGACTGGAAGAATGTCCTCGAAGGTACTCCTCGGTACTCCTCGAATCGTTGAGATGCAGTAACTGCTCATGTCTGCGATTATTGATTATTACTGACTTCTTTCTGTGAGTAGTTTGTTTTGAACTCGCATCGAGAACTCGCATCGAAACGACTATTGT

Full Affymetrix probeset data:

Annotations for 1628199_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720