FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628201_at:

>probe:Drosophila_2:1628201_at:512:319; Interrogation_Position=1504; Antisense; GCCGCTTGCCGGTAAATATTGCTAT
>probe:Drosophila_2:1628201_at:386:359; Interrogation_Position=1535; Antisense; GCAACAGACGGCTCAACGCGAGATA
>probe:Drosophila_2:1628201_at:316:95; Interrogation_Position=1555; Antisense; AGATACATCGTTTGTGGCCGTCCCA
>probe:Drosophila_2:1628201_at:688:263; Interrogation_Position=1578; Antisense; CAGCAGTGCAGCATCGAGCCGATTA
>probe:Drosophila_2:1628201_at:615:415; Interrogation_Position=1593; Antisense; GAGCCGATTAAGCATTCACGCCAGA
>probe:Drosophila_2:1628201_at:367:133; Interrogation_Position=1610; Antisense; ACGCCAGAAGGCATTCCACAACGGA
>probe:Drosophila_2:1628201_at:545:415; Interrogation_Position=1633; Antisense; GAGCCGGCATCCTGATGACTGTCAA
>probe:Drosophila_2:1628201_at:636:629; Interrogation_Position=1675; Antisense; TCCTAGGTGCTTCTGCATTGGGCAA
>probe:Drosophila_2:1628201_at:533:71; Interrogation_Position=1704; Antisense; AGGATCGACGGACACGTTCTCGGCT
>probe:Drosophila_2:1628201_at:604:153; Interrogation_Position=1766; Antisense; ACAGGTCTGCGTTGATGATTACATG
>probe:Drosophila_2:1628201_at:511:13; Interrogation_Position=1783; Antisense; ATTACATGCAGGACCAGCTCATCAT
>probe:Drosophila_2:1628201_at:516:447; Interrogation_Position=1838; Antisense; GATGCGCACAGGCAAGCTGACCAAT
>probe:Drosophila_2:1628201_at:506:131; Interrogation_Position=1872; Antisense; ACCGCCATCAATGTAGCCGAGCAAA
>probe:Drosophila_2:1628201_at:23:333; Interrogation_Position=1933; Antisense; GCGGCCAGATGCTAGTCAGCTGCAA

Paste this into a BLAST search page for me
GCCGCTTGCCGGTAAATATTGCTATGCAACAGACGGCTCAACGCGAGATAAGATACATCGTTTGTGGCCGTCCCACAGCAGTGCAGCATCGAGCCGATTAGAGCCGATTAAGCATTCACGCCAGAACGCCAGAAGGCATTCCACAACGGAGAGCCGGCATCCTGATGACTGTCAATCCTAGGTGCTTCTGCATTGGGCAAAGGATCGACGGACACGTTCTCGGCTACAGGTCTGCGTTGATGATTACATGATTACATGCAGGACCAGCTCATCATGATGCGCACAGGCAAGCTGACCAATACCGCCATCAATGTAGCCGAGCAAAGCGGCCAGATGCTAGTCAGCTGCAA

Full Affymetrix probeset data:

Annotations for 1628201_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720