Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628202_at:

>probe:Drosophila_2:1628202_at:115:145; Interrogation_Position=1001; Antisense; ACAAGAAGGCCATGTACCCCGTAGT
>probe:Drosophila_2:1628202_at:577:677; Interrogation_Position=1022; Antisense; TAGTCGGAGCTCTTCTGGGCACCTG
>probe:Drosophila_2:1628202_at:487:711; Interrogation_Position=1123; Antisense; TTCACCGGTGGCTCTGTGCTAAAGG
>probe:Drosophila_2:1628202_at:434:227; Interrogation_Position=1144; Antisense; AAGGCCAATCCCAATGTAATGCATG
>probe:Drosophila_2:1628202_at:303:381; Interrogation_Position=1192; Antisense; GAACCGGATAGCGAGTCAACTGAGA
>probe:Drosophila_2:1628202_at:614:379; Interrogation_Position=1233; Antisense; GAAGCCAGAATGACCCGCAGGAGGA
>probe:Drosophila_2:1628202_at:426:349; Interrogation_Position=1249; Antisense; GCAGGAGGAAGTGCCCGATCCGCAT
>probe:Drosophila_2:1628202_at:3:187; Interrogation_Position=1309; Antisense; AACACACGACGTTTGGAGGCAGCCA
>probe:Drosophila_2:1628202_at:227:439; Interrogation_Position=1324; Antisense; GAGGCAGCCACCAACGGAGTGATTT
>probe:Drosophila_2:1628202_at:544:433; Interrogation_Position=1340; Antisense; GAGTGATTTGCAGCGTGCGCAGCTA
>probe:Drosophila_2:1628202_at:547:297; Interrogation_Position=1357; Antisense; CGCAGCTATTGTTCCGTTCAGTAGA
>probe:Drosophila_2:1628202_at:320:23; Interrogation_Position=1405; Antisense; ATATCCCCATTTTGTGATTTTCCAC
>probe:Drosophila_2:1628202_at:381:461; Interrogation_Position=1420; Antisense; GATTTTCCACGTGCAATAGAGCTAA
>probe:Drosophila_2:1628202_at:203:149; Interrogation_Position=1484; Antisense; ACTTGTTGTTCACATGACACCGCAA

Paste this into a BLAST search page for me
ACAAGAAGGCCATGTACCCCGTAGTTAGTCGGAGCTCTTCTGGGCACCTGTTCACCGGTGGCTCTGTGCTAAAGGAAGGCCAATCCCAATGTAATGCATGGAACCGGATAGCGAGTCAACTGAGAGAAGCCAGAATGACCCGCAGGAGGAGCAGGAGGAAGTGCCCGATCCGCATAACACACGACGTTTGGAGGCAGCCAGAGGCAGCCACCAACGGAGTGATTTGAGTGATTTGCAGCGTGCGCAGCTACGCAGCTATTGTTCCGTTCAGTAGAATATCCCCATTTTGTGATTTTCCACGATTTTCCACGTGCAATAGAGCTAAACTTGTTGTTCACATGACACCGCAA

Full Affymetrix probeset data:

Annotations for 1628202_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime