Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628204_at:

>probe:Drosophila_2:1628204_at:124:357; Interrogation_Position=1456; Antisense; GCAAATCTTTCAGCGCATAGCTCGT
>probe:Drosophila_2:1628204_at:203:367; Interrogation_Position=1493; Antisense; GAATCCATATTGATGCTCTACCTGC
>probe:Drosophila_2:1628204_at:512:673; Interrogation_Position=1511; Antisense; TACCTGCAATCCCTGAACAAGTTCA
>probe:Drosophila_2:1628204_at:145:191; Interrogation_Position=1535; Antisense; AACATTGCCGCCCAGGAGGAGCTGA
>probe:Drosophila_2:1628204_at:210:721; Interrogation_Position=1607; Antisense; TTGCGACGCTTGGTCAGCTATTCAA
>probe:Drosophila_2:1628204_at:143:367; Interrogation_Position=1640; Antisense; GAATCCAAGTCGGTGGCTTGCTTTT
>probe:Drosophila_2:1628204_at:695:343; Interrogation_Position=1655; Antisense; GCTTGCTTTTTGTTGTCGCATTCAA
>probe:Drosophila_2:1628204_at:441:455; Interrogation_Position=1685; Antisense; GATACGGCGATATCCCAGGTGGCCA
>probe:Drosophila_2:1628204_at:674:267; Interrogation_Position=1700; Antisense; CAGGTGGCCATCGATATGCTGGGCA
>probe:Drosophila_2:1628204_at:504:361; Interrogation_Position=1833; Antisense; GCAAGTTTCTGGAGGCGGCTCATAA
>probe:Drosophila_2:1628204_at:611:443; Interrogation_Position=1865; Antisense; GATGATCTAATATTCCACAGCGTAT
>probe:Drosophila_2:1628204_at:468:327; Interrogation_Position=1884; Antisense; GCGTATACCGCTTTTTCCAAATGAG
>probe:Drosophila_2:1628204_at:57:681; Interrogation_Position=1922; Antisense; TATGAAACCCTATCTTTTCCCAAGG
>probe:Drosophila_2:1628204_at:263:579; Interrogation_Position=1971; Antisense; TGCGGCATCACTTTTTAAACCTTTG

Paste this into a BLAST search page for me
GCAAATCTTTCAGCGCATAGCTCGTGAATCCATATTGATGCTCTACCTGCTACCTGCAATCCCTGAACAAGTTCAAACATTGCCGCCCAGGAGGAGCTGATTGCGACGCTTGGTCAGCTATTCAAGAATCCAAGTCGGTGGCTTGCTTTTGCTTGCTTTTTGTTGTCGCATTCAAGATACGGCGATATCCCAGGTGGCCACAGGTGGCCATCGATATGCTGGGCAGCAAGTTTCTGGAGGCGGCTCATAAGATGATCTAATATTCCACAGCGTATGCGTATACCGCTTTTTCCAAATGAGTATGAAACCCTATCTTTTCCCAAGGTGCGGCATCACTTTTTAAACCTTTG

Full Affymetrix probeset data:

Annotations for 1628204_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime