Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628207_at:

>probe:Drosophila_2:1628207_at:328:307; Interrogation_Position=2051; Antisense; CCATCATCTGGTCGGAGTTTGTCAA
>probe:Drosophila_2:1628207_at:645:613; Interrogation_Position=2147; Antisense; TGAACCGACCCATGAACACGCTGAA
>probe:Drosophila_2:1628207_at:108:701; Interrogation_Position=2188; Antisense; TTTTTACCGGCCTACATACTGGACG
>probe:Drosophila_2:1628207_at:598:173; Interrogation_Position=2272; Antisense; AAAGCTGTGGAATGCCTCGAGTACT
>probe:Drosophila_2:1628207_at:114:581; Interrogation_Position=2311; Antisense; TGGCGCTTCAAGGACGACAACGTAC
>probe:Drosophila_2:1628207_at:314:621; Interrogation_Position=2342; Antisense; TGCTGCACACGCTAAGTCCCAAGGA
>probe:Drosophila_2:1628207_at:526:77; Interrogation_Position=2363; Antisense; AGGATCGCGAGATCTTCGTCTTCGA
>probe:Drosophila_2:1628207_at:675:407; Interrogation_Position=2386; Antisense; GACGTGCGCCACATTAACTGGGACA
>probe:Drosophila_2:1628207_at:137:123; Interrogation_Position=2420; Antisense; AGCGCTACGTTCTGGGCTTCAGGGA
>probe:Drosophila_2:1628207_at:171:107; Interrogation_Position=2485; Antisense; AGAAAACGCATGCTCAGGCTCTACT
>probe:Drosophila_2:1628207_at:474:71; Interrogation_Position=2500; Antisense; AGGCTCTACTATCTGCATCAGCTGA
>probe:Drosophila_2:1628207_at:556:337; Interrogation_Position=2544; Antisense; GCTCACCTGGCGCTTTTTAATGTCG
>probe:Drosophila_2:1628207_at:681:315; Interrogation_Position=2579; Antisense; GCCTGAATGACTTGTGGAGCTCCTT
>probe:Drosophila_2:1628207_at:223:577; Interrogation_Position=2625; Antisense; GGCGCGCTTGATACCCTTTTTGTAA

Paste this into a BLAST search page for me
CCATCATCTGGTCGGAGTTTGTCAATGAACCGACCCATGAACACGCTGAATTTTTACCGGCCTACATACTGGACGAAAGCTGTGGAATGCCTCGAGTACTTGGCGCTTCAAGGACGACAACGTACTGCTGCACACGCTAAGTCCCAAGGAAGGATCGCGAGATCTTCGTCTTCGAGACGTGCGCCACATTAACTGGGACAAGCGCTACGTTCTGGGCTTCAGGGAAGAAAACGCATGCTCAGGCTCTACTAGGCTCTACTATCTGCATCAGCTGAGCTCACCTGGCGCTTTTTAATGTCGGCCTGAATGACTTGTGGAGCTCCTTGGCGCGCTTGATACCCTTTTTGTAA

Full Affymetrix probeset data:

Annotations for 1628207_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime