FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628208_at:

>probe:Drosophila_2:1628208_at:398:277; Interrogation_Position=196; Antisense; CTAGGATTTCTAGTGCGCGGCGGTC
>probe:Drosophila_2:1628208_at:22:361; Interrogation_Position=229; Antisense; GCAACCGTCTACTACACACAAAAGG
>probe:Drosophila_2:1628208_at:705:403; Interrogation_Position=268; Antisense; GACTCTGACCAGACGGACAAGCTGT
>probe:Drosophila_2:1628208_at:407:625; Interrogation_Position=314; Antisense; TGCGCCCGCATGTCCAGAAGCTGGA
>probe:Drosophila_2:1628208_at:74:377; Interrogation_Position=339; Antisense; GAAGCAGCTGCCCTTCGAAGTGCCG
>probe:Drosophila_2:1628208_at:697:181; Interrogation_Position=373; Antisense; AAAACCGGCGAGATGCGCTTCCTGG
>probe:Drosophila_2:1628208_at:137:581; Interrogation_Position=395; Antisense; TGGCCAAGCACTACTACAACGAGGG
>probe:Drosophila_2:1628208_at:441:433; Interrogation_Position=415; Antisense; GAGGGCGTGAAGAACACCTTCCGTT
>probe:Drosophila_2:1628208_at:100:539; Interrogation_Position=483; Antisense; GGTCAAGGACACGTTCCAGGACTTT
>probe:Drosophila_2:1628208_at:534:143; Interrogation_Position=567; Antisense; ACTGCTCTTCAATGGCAGGCTGTTT
>probe:Drosophila_2:1628208_at:122:269; Interrogation_Position=582; Antisense; CAGGCTGTTTTCGTGTTAGCTCATA
>probe:Drosophila_2:1628208_at:422:657; Interrogation_Position=632; Antisense; TAATGTGTCGTTATTCCTCGATCCG
>probe:Drosophila_2:1628208_at:467:25; Interrogation_Position=678; Antisense; ATAGATCTGTTCTCGACGTACTGAA
>probe:Drosophila_2:1628208_at:277:519; Interrogation_Position=747; Antisense; GTGGTAGGCGTTAAGATCGCACTTA

Paste this into a BLAST search page for me
CTAGGATTTCTAGTGCGCGGCGGTCGCAACCGTCTACTACACACAAAAGGGACTCTGACCAGACGGACAAGCTGTTGCGCCCGCATGTCCAGAAGCTGGAGAAGCAGCTGCCCTTCGAAGTGCCGAAAACCGGCGAGATGCGCTTCCTGGTGGCCAAGCACTACTACAACGAGGGGAGGGCGTGAAGAACACCTTCCGTTGGTCAAGGACACGTTCCAGGACTTTACTGCTCTTCAATGGCAGGCTGTTTCAGGCTGTTTTCGTGTTAGCTCATATAATGTGTCGTTATTCCTCGATCCGATAGATCTGTTCTCGACGTACTGAAGTGGTAGGCGTTAAGATCGCACTTA

Full Affymetrix probeset data:

Annotations for 1628208_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720