FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628209_at:

>probe:Drosophila_2:1628209_at:619:417; Interrogation_Position=274; Antisense; GAGCTGCTTTCTTTAATCATCGTTG
>probe:Drosophila_2:1628209_at:314:645; Interrogation_Position=283; Antisense; TCTTTAATCATCGTTGGCTGTGCCT
>probe:Drosophila_2:1628209_at:605:569; Interrogation_Position=298; Antisense; GGCTGTGCCTGGTCCAATTGATAGT
>probe:Drosophila_2:1628209_at:392:259; Interrogation_Position=326; Antisense; CACTTTGACATTACTTCTCTGCGTT
>probe:Drosophila_2:1628209_at:483:643; Interrogation_Position=341; Antisense; TCTCTGCGTTTATCTGGGTTTCCTG
>probe:Drosophila_2:1628209_at:468:695; Interrogation_Position=359; Antisense; TTTCCTGCTGATTCTCGTGTTTTAC
>probe:Drosophila_2:1628209_at:12:513; Interrogation_Position=375; Antisense; GTGTTTTACGATTTCTGTTTGGCAA
>probe:Drosophila_2:1628209_at:187:479; Interrogation_Position=391; Antisense; GTTTGGCAACCACTGAACCACTGGA
>probe:Drosophila_2:1628209_at:381:561; Interrogation_Position=413; Antisense; GGAACACTGAACCACTCGCTTGGGA
>probe:Drosophila_2:1628209_at:372:709; Interrogation_Position=468; Antisense; TTCACCCAGTGGAGTAGACCGAGTA
>probe:Drosophila_2:1628209_at:610:425; Interrogation_Position=488; Antisense; GAGTAGACTACTTTGGGCCAACGCA
>probe:Drosophila_2:1628209_at:141:323; Interrogation_Position=562; Antisense; GCGCCTCGAGAAGATGTGCACCGAA
>probe:Drosophila_2:1628209_at:162:371; Interrogation_Position=588; Antisense; GAAGGCAAATCAGCCCGAGACCCAA
>probe:Drosophila_2:1628209_at:728:411; Interrogation_Position=613; Antisense; GACCGAGGCACCCTTTACGTGGCAA

Paste this into a BLAST search page for me
GAGCTGCTTTCTTTAATCATCGTTGTCTTTAATCATCGTTGGCTGTGCCTGGCTGTGCCTGGTCCAATTGATAGTCACTTTGACATTACTTCTCTGCGTTTCTCTGCGTTTATCTGGGTTTCCTGTTTCCTGCTGATTCTCGTGTTTTACGTGTTTTACGATTTCTGTTTGGCAAGTTTGGCAACCACTGAACCACTGGAGGAACACTGAACCACTCGCTTGGGATTCACCCAGTGGAGTAGACCGAGTAGAGTAGACTACTTTGGGCCAACGCAGCGCCTCGAGAAGATGTGCACCGAAGAAGGCAAATCAGCCCGAGACCCAAGACCGAGGCACCCTTTACGTGGCAA

Full Affymetrix probeset data:

Annotations for 1628209_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720