Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628210_at:

>probe:Drosophila_2:1628210_at:182:239; Interrogation_Position=1926; Antisense; AATCTGCGGACAACTGGCGTGCTGA
>probe:Drosophila_2:1628210_at:658:619; Interrogation_Position=1956; Antisense; TGCTGAGCAGTCCACCAAACCAATA
>probe:Drosophila_2:1628210_at:667:699; Interrogation_Position=2003; Antisense; TTTTTTGTTCATTTACCCGCAGCAG
>probe:Drosophila_2:1628210_at:681:713; Interrogation_Position=2028; Antisense; TTCGGGCTCGTTGTAGTTGTTTTGT
>probe:Drosophila_2:1628210_at:515:491; Interrogation_Position=2051; Antisense; GTAAATTCGTTTATCGCCATCGCGA
>probe:Drosophila_2:1628210_at:479:461; Interrogation_Position=2074; Antisense; GATTAGCTACGGCTGATCACTCCAT
>probe:Drosophila_2:1628210_at:649:453; Interrogation_Position=2088; Antisense; GATCACTCCATCTAGACGTTTGTAC
>probe:Drosophila_2:1628210_at:522:429; Interrogation_Position=2116; Antisense; GAGTATAAGCATATCCGCAATCGTT
>probe:Drosophila_2:1628210_at:496:393; Interrogation_Position=2198; Antisense; GACGCTTTACGTCATCTACTTAAAT
>probe:Drosophila_2:1628210_at:365:507; Interrogation_Position=2242; Antisense; GTGCCCTCGCACAATATGTAGGCGT
>probe:Drosophila_2:1628210_at:258:479; Interrogation_Position=2348; Antisense; GTTTAAGCGTCTTCGAATCCTGCAA
>probe:Drosophila_2:1628210_at:452:365; Interrogation_Position=2362; Antisense; GAATCCTGCAAGTTCAACGCATGTA
>probe:Drosophila_2:1628210_at:703:199; Interrogation_Position=2377; Antisense; AACGCATGTAATTACTGTCCCTAAC
>probe:Drosophila_2:1628210_at:512:503; Interrogation_Position=2393; Antisense; GTCCCTAACACATTTTTACTCGCTA

Paste this into a BLAST search page for me
AATCTGCGGACAACTGGCGTGCTGATGCTGAGCAGTCCACCAAACCAATATTTTTTGTTCATTTACCCGCAGCAGTTCGGGCTCGTTGTAGTTGTTTTGTGTAAATTCGTTTATCGCCATCGCGAGATTAGCTACGGCTGATCACTCCATGATCACTCCATCTAGACGTTTGTACGAGTATAAGCATATCCGCAATCGTTGACGCTTTACGTCATCTACTTAAATGTGCCCTCGCACAATATGTAGGCGTGTTTAAGCGTCTTCGAATCCTGCAAGAATCCTGCAAGTTCAACGCATGTAAACGCATGTAATTACTGTCCCTAACGTCCCTAACACATTTTTACTCGCTA

Full Affymetrix probeset data:

Annotations for 1628210_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime