FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628212_at:

>probe:Drosophila_2:1628212_at:176:279; Interrogation_Position=1881; Antisense; CTATCGCTGTGAATTGCCTTGGCAA
>probe:Drosophila_2:1628212_at:493:421; Interrogation_Position=1908; Antisense; GAGCAACCGCTCTGGTCAATTGCGA
>probe:Drosophila_2:1628212_at:396:7; Interrogation_Position=1926; Antisense; ATTGCGACCGCATCATCAAAGACAC
>probe:Drosophila_2:1628212_at:304:135; Interrogation_Position=1955; Antisense; ACGAAACCGATGATGCGCACAGCTT
>probe:Drosophila_2:1628212_at:635:451; Interrogation_Position=1994; Antisense; GATCTGTGAACTCCAATGGCGGTGA
>probe:Drosophila_2:1628212_at:229:155; Interrogation_Position=2045; Antisense; ACAGCACGCGGAGAGAAGCACCCTA
>probe:Drosophila_2:1628212_at:287:617; Interrogation_Position=2081; Antisense; TGCACAATCTACAAGCGCGGGAACT
>probe:Drosophila_2:1628212_at:356:199; Interrogation_Position=2114; Antisense; AACGCTGCCAGCAATTCTATAGCTC
>probe:Drosophila_2:1628212_at:25:631; Interrogation_Position=2173; Antisense; TCCTCGTCGGGAAGCAGTCGCAGTA
>probe:Drosophila_2:1628212_at:93:339; Interrogation_Position=2225; Antisense; GCTACTATATAGAGATGGCGCCCAG
>probe:Drosophila_2:1628212_at:149:549; Interrogation_Position=2303; Antisense; GGAGTAATGCCCTCGGATGCCGGAC
>probe:Drosophila_2:1628212_at:267:333; Interrogation_Position=2386; Antisense; GCGGCCATCAAGTCGGTGAGCAGCA
>probe:Drosophila_2:1628212_at:582:419; Interrogation_Position=2403; Antisense; GAGCAGCAGACTGATGACGCCCAGT
>probe:Drosophila_2:1628212_at:31:719; Interrogation_Position=2427; Antisense; TTCGCGGAGGCTGAACATCTGGTGA

Paste this into a BLAST search page for me
CTATCGCTGTGAATTGCCTTGGCAAGAGCAACCGCTCTGGTCAATTGCGAATTGCGACCGCATCATCAAAGACACACGAAACCGATGATGCGCACAGCTTGATCTGTGAACTCCAATGGCGGTGAACAGCACGCGGAGAGAAGCACCCTATGCACAATCTACAAGCGCGGGAACTAACGCTGCCAGCAATTCTATAGCTCTCCTCGTCGGGAAGCAGTCGCAGTAGCTACTATATAGAGATGGCGCCCAGGGAGTAATGCCCTCGGATGCCGGACGCGGCCATCAAGTCGGTGAGCAGCAGAGCAGCAGACTGATGACGCCCAGTTTCGCGGAGGCTGAACATCTGGTGA

Full Affymetrix probeset data:

Annotations for 1628212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720