FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628214_at:

>probe:Drosophila_2:1628214_at:578:145; Interrogation_Position=1002; Antisense; ACTCGGCTTTTGCTGACATCCTGGG
>probe:Drosophila_2:1628214_at:597:371; Interrogation_Position=1091; Antisense; GAAGGACCATATTCCCTGCTGGGAA
>probe:Drosophila_2:1628214_at:146:503; Interrogation_Position=1117; Antisense; GTCGCGGAAGCACGTTAGAAACCTA
>probe:Drosophila_2:1628214_at:51:677; Interrogation_Position=1140; Antisense; TAGTCAACCTTCATGGACTGCCCAG
>probe:Drosophila_2:1628214_at:13:625; Interrogation_Position=1158; Antisense; TGCCCAGTAGCATCTTCAAGCGACA
>probe:Drosophila_2:1628214_at:52:535; Interrogation_Position=1207; Antisense; GGTGCACTACATGGACCAGGCCATA
>probe:Drosophila_2:1628214_at:71:435; Interrogation_Position=1238; Antisense; GAGGGTGGCGTTCACAACCTGACAC
>probe:Drosophila_2:1628214_at:382:611; Interrogation_Position=1257; Antisense; TGACACCGGATGCTTTGCGCTACTC
>probe:Drosophila_2:1628214_at:673:143; Interrogation_Position=1278; Antisense; ACTCCTGCTATCTGCGCGGATTGAA
>probe:Drosophila_2:1628214_at:524:463; Interrogation_Position=1296; Antisense; GATTGAATCCCGACAGCCTGAGCAG
>probe:Drosophila_2:1628214_at:486:535; Interrogation_Position=1351; Antisense; GGTCAAGGTGTCCACGTCGATACAA
>probe:Drosophila_2:1628214_at:257:191; Interrogation_Position=1380; Antisense; AACATATCACGCTGTTCCTGCACTT
>probe:Drosophila_2:1628214_at:657:561; Interrogation_Position=1440; Antisense; GGAAGACCATCTACGGCAAGTGCCC
>probe:Drosophila_2:1628214_at:407:529; Interrogation_Position=1475; Antisense; GGGTCCTCTGGTCGTTAGCTATTTG

Paste this into a BLAST search page for me
ACTCGGCTTTTGCTGACATCCTGGGGAAGGACCATATTCCCTGCTGGGAAGTCGCGGAAGCACGTTAGAAACCTATAGTCAACCTTCATGGACTGCCCAGTGCCCAGTAGCATCTTCAAGCGACAGGTGCACTACATGGACCAGGCCATAGAGGGTGGCGTTCACAACCTGACACTGACACCGGATGCTTTGCGCTACTCACTCCTGCTATCTGCGCGGATTGAAGATTGAATCCCGACAGCCTGAGCAGGGTCAAGGTGTCCACGTCGATACAAAACATATCACGCTGTTCCTGCACTTGGAAGACCATCTACGGCAAGTGCCCGGGTCCTCTGGTCGTTAGCTATTTG

Full Affymetrix probeset data:

Annotations for 1628214_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720