FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628216_at:

>probe:Drosophila_2:1628216_at:708:291; Interrogation_Position=1054; Antisense; CGTGCCCGCAACTTGAAGCTTAAGA
>probe:Drosophila_2:1628216_at:44:81; Interrogation_Position=1112; Antisense; AGGGACGGACTGACAGCGATCCCGA
>probe:Drosophila_2:1628216_at:104:633; Interrogation_Position=1131; Antisense; TCCCGAGGATGATGCAGAGTACTAC
>probe:Drosophila_2:1628216_at:16:65; Interrogation_Position=1198; Antisense; ATGGAAGCGAAGTCCTCCCGAAAGC
>probe:Drosophila_2:1628216_at:237:161; Interrogation_Position=1256; Antisense; ACAAGCGCGCTAAACTGGATACCAA
>probe:Drosophila_2:1628216_at:713:367; Interrogation_Position=1287; Antisense; GAATGACAAATCTGAGCGCACGGAC
>probe:Drosophila_2:1628216_at:353:417; Interrogation_Position=1300; Antisense; GAGCGCACGGACAAGTACGATCGTA
>probe:Drosophila_2:1628216_at:27:75; Interrogation_Position=1325; Antisense; AGGACAAGTTCGATCGCAAGGACAA
>probe:Drosophila_2:1628216_at:214:559; Interrogation_Position=1353; Antisense; GGACAAATTCGACCCCAAGAACAGG
>probe:Drosophila_2:1628216_at:593:153; Interrogation_Position=1373; Antisense; ACAGGAGAGCCAAGTTCGATCCCAA
>probe:Drosophila_2:1628216_at:704:713; Interrogation_Position=1387; Antisense; TTCGATCCCAAAAACAAGCGCGCCA
>probe:Drosophila_2:1628216_at:504:205; Interrogation_Position=1402; Antisense; AAGCGCGCCAAGTTTGACCACAGAA
>probe:Drosophila_2:1628216_at:202:713; Interrogation_Position=926; Antisense; TTCTGACGGGCGAAGTACTGTATCA
>probe:Drosophila_2:1628216_at:289:489; Interrogation_Position=940; Antisense; GTACTGTATCACGACCATGTGGTCA

Paste this into a BLAST search page for me
CGTGCCCGCAACTTGAAGCTTAAGAAGGGACGGACTGACAGCGATCCCGATCCCGAGGATGATGCAGAGTACTACATGGAAGCGAAGTCCTCCCGAAAGCACAAGCGCGCTAAACTGGATACCAAGAATGACAAATCTGAGCGCACGGACGAGCGCACGGACAAGTACGATCGTAAGGACAAGTTCGATCGCAAGGACAAGGACAAATTCGACCCCAAGAACAGGACAGGAGAGCCAAGTTCGATCCCAATTCGATCCCAAAAACAAGCGCGCCAAAGCGCGCCAAGTTTGACCACAGAATTCTGACGGGCGAAGTACTGTATCAGTACTGTATCACGACCATGTGGTCA

Full Affymetrix probeset data:

Annotations for 1628216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720