Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628221_at:

>probe:Drosophila_2:1628221_at:381:135; Interrogation_Position=1073; Antisense; ACGCTGCTGGGTGCTATTGGAGCCA
>probe:Drosophila_2:1628221_at:533:691; Interrogation_Position=1087; Antisense; TATTGGAGCCATTCTGGCGGGCCTG
>probe:Drosophila_2:1628221_at:229:523; Interrogation_Position=1105; Antisense; GGGCCTGCTGAACTCCAATAAGCGA
>probe:Drosophila_2:1628221_at:691:103; Interrogation_Position=1200; Antisense; AGACGCAGTTGATCTGGGTGGCCTA
>probe:Drosophila_2:1628221_at:214:521; Interrogation_Position=1217; Antisense; GTGGCCTACGTGAACTATGTGCTTT
>probe:Drosophila_2:1628221_at:398:681; Interrogation_Position=1232; Antisense; TATGTGCTTTTCTGCACCGTATTCT
>probe:Drosophila_2:1628221_at:94:481; Interrogation_Position=1250; Antisense; GTATTCTTCTTCATCATCACGGTGG
>probe:Drosophila_2:1628221_at:335:549; Interrogation_Position=1303; Antisense; GGAGGACAGTTTCGGCTTGATCTTC
>probe:Drosophila_2:1628221_at:272:29; Interrogation_Position=1335; Antisense; ATACGTTGGTGGGTCTGATCCTGCA
>probe:Drosophila_2:1628221_at:414:449; Interrogation_Position=1351; Antisense; GATCCTGCAGACTATTCTGACCGTT
>probe:Drosophila_2:1628221_at:704:111; Interrogation_Position=1407; Antisense; AGCCGCGGGATCAGTACGTGGTTTA
>probe:Drosophila_2:1628221_at:387:669; Interrogation_Position=1430; Antisense; TACGGTAGCTACTTTGTGGTCTTGG
>probe:Drosophila_2:1628221_at:269:531; Interrogation_Position=1472; Antisense; GGGTCTATCTGCGTGAAACTGTTTT
>probe:Drosophila_2:1628221_at:34:151; Interrogation_Position=1600; Antisense; ACAGGACTTCTTATTTACTATCTTA

Paste this into a BLAST search page for me
ACGCTGCTGGGTGCTATTGGAGCCATATTGGAGCCATTCTGGCGGGCCTGGGGCCTGCTGAACTCCAATAAGCGAAGACGCAGTTGATCTGGGTGGCCTAGTGGCCTACGTGAACTATGTGCTTTTATGTGCTTTTCTGCACCGTATTCTGTATTCTTCTTCATCATCACGGTGGGGAGGACAGTTTCGGCTTGATCTTCATACGTTGGTGGGTCTGATCCTGCAGATCCTGCAGACTATTCTGACCGTTAGCCGCGGGATCAGTACGTGGTTTATACGGTAGCTACTTTGTGGTCTTGGGGGTCTATCTGCGTGAAACTGTTTTACAGGACTTCTTATTTACTATCTTA

Full Affymetrix probeset data:

Annotations for 1628221_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime