FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628222_at:

>probe:Drosophila_2:1628222_at:643:547; Interrogation_Position=1023; Antisense; GGATGATTACAATGCCTTCTGGCAT
>probe:Drosophila_2:1628222_at:73:505; Interrogation_Position=1074; Antisense; GTCCTTTGCCAACAGCTGTGCGAAT
>probe:Drosophila_2:1628222_at:241:235; Interrogation_Position=1096; Antisense; AATCCTGTGGCCCTATACTTCGTGA
>probe:Drosophila_2:1628222_at:337:323; Interrogation_Position=1124; Antisense; GCGCCTTTCGCAAGCATTTCAATAG
>probe:Drosophila_2:1628222_at:43:243; Interrogation_Position=1160; Antisense; AATATTTTTGCTTGACCCGCGAATC
>probe:Drosophila_2:1628222_at:651:5; Interrogation_Position=1192; Antisense; ATTGTTCCGAAAACTGCACTCTTCT
>probe:Drosophila_2:1628222_at:334:265; Interrogation_Position=1221; Antisense; CAGATATCTGTTTTGCCGCGGAGCA
>probe:Drosophila_2:1628222_at:439:457; Interrogation_Position=1276; Antisense; GATACCTTCTGCATGCACCGGGACA
>probe:Drosophila_2:1628222_at:340:119; Interrogation_Position=1369; Antisense; AGCTGTCGCCTGCAGGAAACAACGA
>probe:Drosophila_2:1628222_at:677:553; Interrogation_Position=1426; Antisense; GGAGCCAACATTTCAGCCGTGGAAT
>probe:Drosophila_2:1628222_at:264:565; Interrogation_Position=1446; Antisense; GGAATTGGCATTGCCCGTGCTCCAA
>probe:Drosophila_2:1628222_at:5:695; Interrogation_Position=1515; Antisense; TTTGCCGCTTAACGAGATTGTCCAG
>probe:Drosophila_2:1628222_at:730:465; Interrogation_Position=1530; Antisense; GATTGTCCAGCAGACCAGGTCGAGT
>probe:Drosophila_2:1628222_at:358:501; Interrogation_Position=1548; Antisense; GTCGAGTCCGGCCAAGTTCCAGGAA

Paste this into a BLAST search page for me
GGATGATTACAATGCCTTCTGGCATGTCCTTTGCCAACAGCTGTGCGAATAATCCTGTGGCCCTATACTTCGTGAGCGCCTTTCGCAAGCATTTCAATAGAATATTTTTGCTTGACCCGCGAATCATTGTTCCGAAAACTGCACTCTTCTCAGATATCTGTTTTGCCGCGGAGCAGATACCTTCTGCATGCACCGGGACAAGCTGTCGCCTGCAGGAAACAACGAGGAGCCAACATTTCAGCCGTGGAATGGAATTGGCATTGCCCGTGCTCCAATTTGCCGCTTAACGAGATTGTCCAGGATTGTCCAGCAGACCAGGTCGAGTGTCGAGTCCGGCCAAGTTCCAGGAA

Full Affymetrix probeset data:

Annotations for 1628222_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720