FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628225_at:

>probe:Drosophila_2:1628225_at:705:619; Interrogation_Position=153; Antisense; TGCTGCACGAATGGTTTCTGGTCTT
>probe:Drosophila_2:1628225_at:85:537; Interrogation_Position=172; Antisense; GGTCTTGGTAAACGAGCACTCATCT
>probe:Drosophila_2:1628225_at:52:21; Interrogation_Position=217; Antisense; ATTTGGCATTTTCCTACTTTTCCTG
>probe:Drosophila_2:1628225_at:112:603; Interrogation_Position=240; Antisense; TGTTTGCCCTAAGTATGCCGCTAAG
>probe:Drosophila_2:1628225_at:673:167; Interrogation_Position=267; Antisense; AAATGTCCTGTGTCAACTGGCTGAT
>probe:Drosophila_2:1628225_at:204:53; Interrogation_Position=362; Antisense; ATGCTTGCCGGATTTCTGATTGTCA
>probe:Drosophila_2:1628225_at:404:465; Interrogation_Position=379; Antisense; GATTGTCAGCCTTGCATTTGTGTTA
>probe:Drosophila_2:1628225_at:309:675; Interrogation_Position=414; Antisense; TAGCTGCTTTAATGGCGGCACCGGA
>probe:Drosophila_2:1628225_at:560:723; Interrogation_Position=455; Antisense; TTGCAACTGGCACTTACTCACTGAG
>probe:Drosophila_2:1628225_at:599:259; Interrogation_Position=473; Antisense; CACTGAGCATATACTCCCTGGTATT
>probe:Drosophila_2:1628225_at:564:723; Interrogation_Position=496; Antisense; TTGTATGTGGTTCTCGACGTGATCT
>probe:Drosophila_2:1628225_at:342:461; Interrogation_Position=524; Antisense; GATTTTATCTCTTCGCATTCTGTAT
>probe:Drosophila_2:1628225_at:673:221; Interrogation_Position=606; Antisense; AAGGGCCTCGACCAAGTTGTTCGAT
>probe:Drosophila_2:1628225_at:659:91; Interrogation_Position=662; Antisense; AGTTCATAGGCCTCTTTGTGCTAAC

Paste this into a BLAST search page for me
TGCTGCACGAATGGTTTCTGGTCTTGGTCTTGGTAAACGAGCACTCATCTATTTGGCATTTTCCTACTTTTCCTGTGTTTGCCCTAAGTATGCCGCTAAGAAATGTCCTGTGTCAACTGGCTGATATGCTTGCCGGATTTCTGATTGTCAGATTGTCAGCCTTGCATTTGTGTTATAGCTGCTTTAATGGCGGCACCGGATTGCAACTGGCACTTACTCACTGAGCACTGAGCATATACTCCCTGGTATTTTGTATGTGGTTCTCGACGTGATCTGATTTTATCTCTTCGCATTCTGTATAAGGGCCTCGACCAAGTTGTTCGATAGTTCATAGGCCTCTTTGTGCTAAC

Full Affymetrix probeset data:

Annotations for 1628225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720